ID: 1022927604

View in Genome Browser
Species Human (GRCh38)
Location 7:35071763-35071785
Sequence CCCTCCTACTCACCTTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022927596_1022927604 8 Left 1022927596 7:35071732-35071754 CCTCCACATCCCTCTTCTTTCAA No data
Right 1022927604 7:35071763-35071785 CCCTCCTACTCACCTTCTTCAGG No data
1022927593_1022927604 25 Left 1022927593 7:35071715-35071737 CCACTTATGTCCTTTTCCCTCCA No data
Right 1022927604 7:35071763-35071785 CCCTCCTACTCACCTTCTTCAGG No data
1022927599_1022927604 -2 Left 1022927599 7:35071742-35071764 CCTCTTCTTTCAAAATCCCTCCC No data
Right 1022927604 7:35071763-35071785 CCCTCCTACTCACCTTCTTCAGG No data
1022927598_1022927604 -1 Left 1022927598 7:35071741-35071763 CCCTCTTCTTTCAAAATCCCTCC No data
Right 1022927604 7:35071763-35071785 CCCTCCTACTCACCTTCTTCAGG No data
1022927597_1022927604 5 Left 1022927597 7:35071735-35071757 CCACATCCCTCTTCTTTCAAAAT No data
Right 1022927604 7:35071763-35071785 CCCTCCTACTCACCTTCTTCAGG No data
1022927595_1022927604 9 Left 1022927595 7:35071731-35071753 CCCTCCACATCCCTCTTCTTTCA No data
Right 1022927604 7:35071763-35071785 CCCTCCTACTCACCTTCTTCAGG No data
1022927594_1022927604 15 Left 1022927594 7:35071725-35071747 CCTTTTCCCTCCACATCCCTCTT No data
Right 1022927604 7:35071763-35071785 CCCTCCTACTCACCTTCTTCAGG No data
1022927592_1022927604 28 Left 1022927592 7:35071712-35071734 CCACCACTTATGTCCTTTTCCCT No data
Right 1022927604 7:35071763-35071785 CCCTCCTACTCACCTTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022927604 Original CRISPR CCCTCCTACTCACCTTCTTC AGG Intergenic