ID: 1022927836

View in Genome Browser
Species Human (GRCh38)
Location 7:35073980-35074002
Sequence CTCACTACACAGAGATGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022927836_1022927844 11 Left 1022927836 7:35073980-35074002 CCACACCATCTCTGTGTAGTGAG No data
Right 1022927844 7:35074014-35074036 TAAAACTGGAACGGGTGAAGGGG No data
1022927836_1022927845 21 Left 1022927836 7:35073980-35074002 CCACACCATCTCTGTGTAGTGAG No data
Right 1022927845 7:35074024-35074046 ACGGGTGAAGGGGTGAAACTAGG No data
1022927836_1022927846 25 Left 1022927836 7:35073980-35074002 CCACACCATCTCTGTGTAGTGAG No data
Right 1022927846 7:35074028-35074050 GTGAAGGGGTGAAACTAGGAAGG No data
1022927836_1022927839 -3 Left 1022927836 7:35073980-35074002 CCACACCATCTCTGTGTAGTGAG No data
Right 1022927839 7:35074000-35074022 GAGGAAAACTTATGTAAAACTGG No data
1022927836_1022927840 2 Left 1022927836 7:35073980-35074002 CCACACCATCTCTGTGTAGTGAG No data
Right 1022927840 7:35074005-35074027 AAACTTATGTAAAACTGGAACGG No data
1022927836_1022927843 10 Left 1022927836 7:35073980-35074002 CCACACCATCTCTGTGTAGTGAG No data
Right 1022927843 7:35074013-35074035 GTAAAACTGGAACGGGTGAAGGG No data
1022927836_1022927842 9 Left 1022927836 7:35073980-35074002 CCACACCATCTCTGTGTAGTGAG No data
Right 1022927842 7:35074012-35074034 TGTAAAACTGGAACGGGTGAAGG No data
1022927836_1022927841 3 Left 1022927836 7:35073980-35074002 CCACACCATCTCTGTGTAGTGAG No data
Right 1022927841 7:35074006-35074028 AACTTATGTAAAACTGGAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022927836 Original CRISPR CTCACTACACAGAGATGGTG TGG (reversed) Intergenic
No off target data available for this crispr