ID: 1022932389

View in Genome Browser
Species Human (GRCh38)
Location 7:35132460-35132482
Sequence GTGATAGCTGAGATGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022932389_1022932396 29 Left 1022932389 7:35132460-35132482 CCCTGTTCCATCTCAGCTATCAC No data
Right 1022932396 7:35132512-35132534 TTCAAATTTTTGACAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022932389 Original CRISPR GTGATAGCTGAGATGGAACA GGG (reversed) Intergenic
No off target data available for this crispr