ID: 1022932396

View in Genome Browser
Species Human (GRCh38)
Location 7:35132512-35132534
Sequence TTCAAATTTTTGACAAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022932392_1022932396 7 Left 1022932392 7:35132482-35132504 CCAGCCATTTTCCTCCTTAACTG No data
Right 1022932396 7:35132512-35132534 TTCAAATTTTTGACAAATTTTGG No data
1022932395_1022932396 -7 Left 1022932395 7:35132496-35132518 CCTTAACTGTTGATTTTTCAAAT No data
Right 1022932396 7:35132512-35132534 TTCAAATTTTTGACAAATTTTGG No data
1022932390_1022932396 28 Left 1022932390 7:35132461-35132483 CCTGTTCCATCTCAGCTATCACC No data
Right 1022932396 7:35132512-35132534 TTCAAATTTTTGACAAATTTTGG No data
1022932393_1022932396 3 Left 1022932393 7:35132486-35132508 CCATTTTCCTCCTTAACTGTTGA No data
Right 1022932396 7:35132512-35132534 TTCAAATTTTTGACAAATTTTGG No data
1022932394_1022932396 -4 Left 1022932394 7:35132493-35132515 CCTCCTTAACTGTTGATTTTTCA No data
Right 1022932396 7:35132512-35132534 TTCAAATTTTTGACAAATTTTGG No data
1022932391_1022932396 22 Left 1022932391 7:35132467-35132489 CCATCTCAGCTATCACCAGCCAT No data
Right 1022932396 7:35132512-35132534 TTCAAATTTTTGACAAATTTTGG No data
1022932389_1022932396 29 Left 1022932389 7:35132460-35132482 CCCTGTTCCATCTCAGCTATCAC No data
Right 1022932396 7:35132512-35132534 TTCAAATTTTTGACAAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022932396 Original CRISPR TTCAAATTTTTGACAAATTT TGG Intergenic
No off target data available for this crispr