ID: 1022937614

View in Genome Browser
Species Human (GRCh38)
Location 7:35195678-35195700
Sequence CTGAATATATAGATCAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022937611_1022937614 14 Left 1022937611 7:35195641-35195663 CCACAAGTAACTGGCTGGAATTT No data
Right 1022937614 7:35195678-35195700 CTGAATATATAGATCAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022937614 Original CRISPR CTGAATATATAGATCAAGTT GGG Intergenic
No off target data available for this crispr