ID: 1022939429

View in Genome Browser
Species Human (GRCh38)
Location 7:35218904-35218926
Sequence TGGTGCCTTCTTGGTGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022939429 Original CRISPR TGGTGCCTTCTTGGTGGAAA GGG (reversed) Intronic
900075422 1:812370-812392 TCGTGCAATGTTGGTGGAAATGG + Intergenic
901261389 1:7874459-7874481 TGCAGCCTTCTGGGTGGACATGG - Intergenic
904439318 1:30519987-30520009 TATTGCCTTCATGGTTGAAATGG - Intergenic
906089572 1:43167068-43167090 TGGAGCCTTCTTGGTTGATGTGG - Intronic
907189295 1:52634754-52634776 TGCTGCCCTCTGGGTGGGAAAGG + Intronic
908761872 1:67520134-67520156 TGATTAATTCTTGGTGGAAATGG + Intergenic
909069764 1:70980410-70980432 AGTTTCCTTCTTGGTGGAATGGG + Intronic
909188525 1:72521427-72521449 TGGTGCCTAATTTGTAGAAAAGG - Intergenic
911529287 1:99024896-99024918 TGGTTCCTTTTAGGGGGAAATGG + Intergenic
912978091 1:114347699-114347721 TGATGCCTTCTTCTTGGCAATGG - Intergenic
913094710 1:115505135-115505157 TGCTGTCTTCTTTGTGGATATGG - Intergenic
915358684 1:155272620-155272642 TGATGCATTCTTGGTGTAACTGG + Intronic
915446083 1:155975784-155975806 TGGTCCCTGCTTGGCAGAAAAGG + Intronic
915842056 1:159221651-159221673 TGGAGATCTCTTGGTGGAAATGG - Intergenic
916927960 1:169542677-169542699 TGGTGGCTTGTTGGTGAGAAGGG + Exonic
917921982 1:179758292-179758314 TGATGCCTTGTTAGTTGAAAAGG + Intronic
919798898 1:201338988-201339010 TGGTGGCCTCTTAGTGGGAAGGG - Intergenic
920814087 1:209314798-209314820 TTGTGCCTTCTTGCTGAAAGAGG - Intergenic
922271266 1:224037244-224037266 TCGTGCAATGTTGGTGGAAATGG + Intergenic
923559352 1:235027110-235027132 TGGTGCCATTTTTGTGGAAGTGG - Intergenic
923888294 1:238181916-238181938 TGGTGCCTTAATGTTGGCAAGGG - Intergenic
924389846 1:243542297-243542319 TCTTGCTTTCTTTGTGGAAATGG - Intronic
1063865638 10:10362610-10362632 GGAGGCTTTCTTGGTGGAAATGG + Intergenic
1065461508 10:25970928-25970950 TGGTATTTTCTTTGTGGAAAGGG - Intronic
1066505722 10:36040290-36040312 CAGTGTCTTCTTGGTTGAAAGGG + Intergenic
1069959360 10:72070504-72070526 TGCTGCCTTCCTGTTGGAACAGG - Intronic
1070554034 10:77514435-77514457 TGGTCCCTGCTTGGAGGAAGAGG - Intronic
1071870320 10:89787325-89787347 TGGTGTGTACGTGGTGGAAAGGG - Intergenic
1074536222 10:114330198-114330220 TCGTGCCTTCCTGGGGGGAAGGG - Intronic
1075294960 10:121267016-121267038 GGGTGTGTACTTGGTGGAAAAGG + Intergenic
1077888260 11:6401819-6401841 TGCTGCCTTCTTGGGGGGGAGGG + Intronic
1078709025 11:13772406-13772428 TGCTGCCTTGTTGGTGTACATGG - Intergenic
1079456098 11:20637417-20637439 TGGTGCCATCTACATGGAAATGG - Intronic
1079495422 11:21037862-21037884 TTCTGCCTTATTGCTGGAAATGG + Intronic
1080289577 11:30655731-30655753 TGGTGACTTTTTCTTGGAAAGGG + Intergenic
1081772744 11:45659780-45659802 TGGTGTCTTTTTGGTGGCATAGG - Intronic
1085392898 11:76191533-76191555 TGCTGCCACCTTGGTGGGAAAGG - Intronic
1086596781 11:88581947-88581969 AGGTAGCTTCTGGGTGGAAAGGG - Intronic
1086861849 11:91933725-91933747 TGGTTCCTTCATGGTGGGATGGG - Intergenic
1089582928 11:119492703-119492725 AGGTGCCCTGTTGGGGGAAATGG + Intergenic
1090002508 11:122974847-122974869 TGGTGGTTTCTTGGTGGATTAGG - Intergenic
1090307141 11:125701203-125701225 TTGTGCCCTGTTGGTGGAAATGG + Intergenic
1091540724 12:1458900-1458922 TGGTTCCTTCTGGTGGGAAAAGG - Intronic
1091779452 12:3204726-3204748 TGCTGGCTTCTAGGTGGATAGGG + Intronic
1091935783 12:4433514-4433536 GGTTCCCTTCTTGGAGGAAAGGG - Intronic
1093949681 12:25150688-25150710 TGATGCCTTCTTGCTGAAAATGG + Intronic
1096574210 12:52542659-52542681 TGGTGCCTTCACTGAGGAAATGG + Intergenic
1097769241 12:63561897-63561919 TCATGCATTGTTGGTGGAAATGG - Intronic
1097780844 12:63702846-63702868 CGGTGCCTTCTTGGTGGAAAGGG - Intergenic
1098656847 12:73042006-73042028 TGTTTCCTTCTTGCTGGAGATGG + Intergenic
1100990725 12:100248689-100248711 TCCTGCCTTCTTAGTAGAAAAGG + Intronic
1103821577 12:123702803-123702825 TGTTGCCTTCAAGGTGGAAGGGG + Intronic
1104209947 12:126679030-126679052 TGTAGCCTTCATGGTGGCAAAGG - Intergenic
1104820363 12:131673480-131673502 TGGTGTCTACGTGGTGGAAACGG + Intergenic
1105580484 13:21691412-21691434 AGTTGCCTTCTTGGCTGAAAAGG - Intronic
1106705053 13:32271172-32271194 TGGTGATTTCCAGGTGGAAAAGG + Intronic
1108164266 13:47675899-47675921 TGTTGCCTGTTTGGCGGAAAAGG + Intergenic
1114187532 14:20414063-20414085 TGGTTCCATCTTCCTGGAAAGGG - Intergenic
1114311171 14:21468752-21468774 TGTTGCCATGTTGGTGGGAAAGG - Exonic
1115862223 14:37700201-37700223 TAGTGACTTCTGGGTGGAAGTGG - Intronic
1118032145 14:61828630-61828652 TGGTGCAGACTTGGTAGAAATGG + Intergenic
1120267992 14:82275660-82275682 TGGTGCCTTATTGCTGTAAAAGG + Intergenic
1121456708 14:94043122-94043144 TGGTGCCTTGTAGGAGGACAGGG - Intronic
1121719131 14:96097116-96097138 TGGAGCCTTCTGAGTGGGAAAGG + Intergenic
1124807503 15:32900476-32900498 TGATGACTTCTAGGTAGAAAGGG + Intronic
1125068240 15:35518290-35518312 TGGAGCTTTTTTGGTTGAAATGG - Intronic
1128419100 15:67474640-67474662 TGCTGCTTTCTTTGGGGAAACGG - Intronic
1128646050 15:69379687-69379709 TGGAGGCTTCTTGGAGGACAAGG + Intronic
1130925620 15:88383607-88383629 TGGTGCCTAGGTGGTGGAGAGGG - Intergenic
1132458372 16:36752-36774 AGGAGCCTTCTTGGTGGACGTGG - Intergenic
1133550488 16:6849771-6849793 AGGTGGCTTCTTGGAGGAGATGG - Intronic
1134892931 16:17857084-17857106 TGGTGCCTTCATGGAGAAACAGG - Intergenic
1135899469 16:26443566-26443588 TGGTGCCTTGTTGGTGCAGAGGG - Intergenic
1136028050 16:27482512-27482534 TGTGGCCTCCTTGGCGGAAAAGG + Intronic
1137386599 16:48048079-48048101 TGGTGCCTTCTTCTGTGAAATGG - Intergenic
1138850989 16:60629189-60629211 TGATTTCTTCTTGGTAGAAATGG - Intergenic
1142470729 17:161889-161911 TGGAGCCTGGTGGGTGGAAAAGG - Intronic
1144290850 17:13824831-13824853 TGGTGCATACTTGCTGGAAGAGG + Intergenic
1149494085 17:57106082-57106104 TGATGCCGTGTTGGGGGAAAAGG + Exonic
1151733997 17:75927504-75927526 AAGTGACTTCTTGGTGGGAATGG + Exonic
1153104551 18:1511608-1511630 TGCAGCCTTCTAGGTGGACATGG + Intergenic
1153197055 18:2611865-2611887 TGCTGCTTTCTTGGTGCCAATGG + Intronic
1154246529 18:12703963-12703985 TGGTGCCTTCTGGGTTCACAGGG - Intronic
1157424410 18:47572331-47572353 TGGGTCTTCCTTGGTGGAAAAGG + Intergenic
1157803907 18:50643996-50644018 TAATGCCCTCTCGGTGGAAAGGG + Intronic
1158651547 18:59292381-59292403 TGGTGTATTCTTTGTGGGAAGGG + Intronic
1159530208 18:69646590-69646612 TGGTGCCCATTTGGTGGAGAAGG + Intronic
1160496237 18:79377469-79377491 TGGTGCTTGCTTGGTAGCAATGG - Exonic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1163727033 19:18928714-18928736 TTGGGCCTGCCTGGTGGAAATGG - Intronic
1164841945 19:31399288-31399310 TGGTGCCTTCTTCTTCAAAAAGG + Intergenic
1165191238 19:34065633-34065655 TGGAGCCCTCTTTGTGGAACTGG + Intergenic
1165382090 19:35488828-35488850 TGGTGCTTTCTTCCTGGAAAAGG + Exonic
1166231847 19:41429076-41429098 GGGTGCCTTCTTGGGGAACATGG + Intronic
927327336 2:21820214-21820236 TGGTGTTTTCTGTGTGGAAAAGG + Intergenic
928665952 2:33550867-33550889 TGGGGCCGTCTTTGAGGAAACGG - Intronic
929455082 2:42059718-42059740 TTGTGCCTCCTTGGTGGATGCGG - Intergenic
930789477 2:55309156-55309178 TGGTACCTTCTAGGAGGAGATGG + Exonic
936948067 2:117948915-117948937 TCGTGCCTCCTTGGTAGAAAAGG - Intronic
937203794 2:120223272-120223294 AGGTGCCTTCTTGATGGGTACGG - Exonic
937239914 2:120453303-120453325 TGGGGCCTGCTGGGTGGACAGGG + Intergenic
937421645 2:121761567-121761589 TGCTTACTTTTTGGTGGAAAGGG + Intronic
938723194 2:134084529-134084551 TGGTGACTTGTGGGTGGAAATGG - Intergenic
941045374 2:160669765-160669787 TTGTGCATTGTTGGTGGACAAGG - Intergenic
945123926 2:206487740-206487762 TAATGCCTTCTTGGTTAAAAAGG + Intronic
946315195 2:218906707-218906729 CAGGGCCTTCCTGGTGGAAAGGG + Intergenic
947338019 2:229107166-229107188 TAGAGCCTTCTTGGGGAAAATGG + Intronic
1169487279 20:6043969-6043991 TAGTGTTTACTTGGTGGAAATGG + Intronic
1169747982 20:8962651-8962673 TAGTGCCTTCTGTGTAGAAAAGG + Intronic
1173312981 20:41916927-41916949 TGATGACTTCATGGTAGAAATGG + Intergenic
1175088011 20:56477241-56477263 TGGTGGCGCCTTGGAGGAAATGG + Intronic
1176101523 20:63366670-63366692 TGCTGGCTTCTTGGTGGTGAGGG - Intronic
1178139360 21:29664859-29664881 GTGTGCCTTTTTTGTGGAAAGGG - Intronic
1181601303 22:23953382-23953404 TAGTGCCTCCTTGGTGGAGCTGG + Intergenic
1181607207 22:23987955-23987977 TAGTGCCTCCTTGGTGGAGCTGG - Intergenic
1182560564 22:31155997-31156019 GGATGCATTCCTGGTGGAAAGGG + Intergenic
1183268828 22:36848075-36848097 TGGTGCATTCCTGGGGGAGAAGG + Intergenic
1183973482 22:41496139-41496161 TTGTACTTTCTTGGTGGAGATGG - Intronic
1184711746 22:46254581-46254603 TGGTGCTTTCTTCCTGGGAAGGG + Intergenic
950519552 3:13488851-13488873 TGGTACATTACTGGTGGAAATGG - Intronic
951964081 3:28363046-28363068 TGGGGCCTACTTGGTGGGGAGGG + Intronic
953358413 3:42273816-42273838 TGGTGCCTGCATGGTGGCCATGG + Intergenic
953456050 3:43043170-43043192 TGGGACCTTCACGGTGGAAAGGG - Intronic
954445436 3:50543824-50543846 TGTTGCCTGGTGGGTGGAAAGGG - Intergenic
955468241 3:59258596-59258618 TGGATCCTCCTTGTTGGAAAAGG + Intergenic
957724465 3:84046451-84046473 TGGTTGCTTCTTGGTAGCAAAGG - Intergenic
961678985 3:128586081-128586103 TGATGCCATCATGGTGCAAACGG - Intergenic
962250946 3:133835818-133835840 AGGTGCCATCTAGGAGGAAATGG + Intronic
963003114 3:140701768-140701790 TGGTGCTTTCTGGGAAGAAATGG - Intergenic
964304194 3:155324023-155324045 TGGGATCTTCTTGGGGGAAAGGG - Intergenic
964341523 3:155713592-155713614 GCCTGCCTCCTTGGTGGAAAAGG + Intronic
964464625 3:156977288-156977310 TGTTTCCTTGTTGGAGGAAATGG + Intronic
964808203 3:160634610-160634632 TCGTGCTTTCTTCCTGGAAAGGG - Intergenic
965046000 3:163577315-163577337 TGATGCATTCTTTCTGGAAAAGG - Intergenic
965485476 3:169273189-169273211 TGATGCCTTATTTGTGGCAAAGG - Intronic
966154920 3:176905630-176905652 TGCTGCATTCCTTGTGGAAAAGG - Intergenic
971840525 4:31846513-31846535 TATTGCTTTCTTGGAGGAAAAGG - Intergenic
974306112 4:60142373-60142395 TGTACCCTTCTTAGTGGAAAGGG - Intergenic
977456149 4:97262562-97262584 TGGTGCTAAATTGGTGGAAAGGG - Intronic
978289677 4:107122902-107122924 GGGTACTTTCTTGCTGGAAAAGG - Intronic
979748361 4:124244841-124244863 AGGTGCCTTCTTGGAAGAAGAGG + Intergenic
980173920 4:129322342-129322364 TGGTTCCTACTTTCTGGAAATGG - Intergenic
980229280 4:130027664-130027686 TGGTTCCTTCCTGGAGTAAATGG - Intergenic
981393292 4:144217190-144217212 TGGTGCCTGCGTGGCGGAAAGGG - Intergenic
985321325 4:188714934-188714956 CTGTGTCTCCTTGGTGGAAATGG - Intergenic
986181291 5:5395120-5395142 TGGTGCATTTTTAGTGGAGATGG - Intergenic
986356141 5:6928769-6928791 TGGGGCCTACTTGGGGAAAAGGG - Intergenic
987402063 5:17488102-17488124 TGTTACCTTCTCTGTGGAAAAGG + Intergenic
988528537 5:32007711-32007733 TGTTTCCTTCCTTGTGGAAATGG + Intronic
989002165 5:36772841-36772863 TGCCTCTTTCTTGGTGGAAAGGG - Intergenic
989435207 5:41404832-41404854 TGGGGCCTTCTTGGTCTGAAGGG - Intronic
990777649 5:59321177-59321199 GGGTGCCATGTTGGTGGAACAGG - Intronic
990889929 5:60636855-60636877 TAGTGGCTTCAGGGTGGAAAAGG - Intronic
993115515 5:83715549-83715571 TGGTGCCTGCCTGGTGCAAATGG + Intronic
995763858 5:115594779-115594801 TGGTGCCTTCTTAATGCCAAAGG - Intronic
997693765 5:135845516-135845538 TGGCCCTTTCTTGGTGGACAGGG - Intronic
998336875 5:141380727-141380749 TGGTACCTTCTTTGGAGAAAAGG - Intronic
999141263 5:149363971-149363993 TGGGGCCCTCTTGATGCAAATGG - Intronic
1001304308 5:170560579-170560601 TGGTCCTTTCTTGGTGGTGAAGG + Intronic
1001394446 5:171405872-171405894 TGGTGACAACTTGGTGTAAAGGG - Intronic
1003354326 6:5352451-5352473 TGGTGCTTTCTTTGTGTGAAGGG + Intronic
1006996039 6:38261815-38261837 TGGTGACTCCTGAGTGGAAAAGG + Intronic
1007107675 6:39294821-39294843 GGGGGACTTCTTGGAGGAAAAGG + Intergenic
1007861087 6:44909632-44909654 TGGTGCCATAGTGGTTGAAAAGG - Intronic
1008341159 6:50365881-50365903 TGGTGGCTACTTGGAGGAGAGGG - Intergenic
1008376146 6:50794495-50794517 TTTTGCCTTCTTGGTAAAAATGG + Intergenic
1008702609 6:54119103-54119125 TGGTACATTCATTGTGGAAACGG + Intronic
1011746626 6:90413179-90413201 TGGGGCATTCTTGGTGGAACAGG - Intergenic
1013590106 6:111612599-111612621 TGGTGCCTTCTATGTGTAGAAGG - Intergenic
1014627516 6:123746634-123746656 AAGTGCCTTCTTGGTGCAAATGG - Intergenic
1015043385 6:128748568-128748590 TGGGGCCTGCTTGGGGGTAAAGG + Intergenic
1015361749 6:132347711-132347733 TGTTGCCCTCTAGTTGGAAAAGG + Intronic
1016469970 6:144364913-144364935 AGGGGCCTTCTAAGTGGAAAAGG - Intronic
1017663243 6:156694394-156694416 TGGTGCAATACTGGTGGAAATGG + Intergenic
1019860900 7:3657347-3657369 GGGTTCCCTCTTTGTGGAAAGGG + Intronic
1021077660 7:16324590-16324612 AGGTGCCTTCAAGGTGGCAAGGG - Intronic
1022928512 7:35082975-35082997 TCATGCATTGTTGGTGGAAATGG - Intergenic
1022939429 7:35218904-35218926 TGGTGCCTTCTTGGTGGAAAGGG - Intronic
1024515741 7:50253876-50253898 TGGTTCCCATTTGGTGGAAATGG + Intergenic
1026132252 7:67630244-67630266 TGGTTCCATCTGGGTGGGAAAGG - Intergenic
1026557870 7:71423337-71423359 TGGTACCTTATTTGGGGAAAAGG + Intronic
1029824624 7:103176649-103176671 TCATGCATTGTTGGTGGAAATGG - Intergenic
1030362614 7:108610721-108610743 CTGGTCCTTCTTGGTGGAAATGG + Intergenic
1033171597 7:139089311-139089333 AGGTGGCTTCTTGGAGGAGATGG - Intronic
1034113927 7:148565520-148565542 TGGTGCCTTCTTATAAGAAAGGG - Intergenic
1034697380 7:153065877-153065899 TGGTGGTATCCTGGTGGAAAAGG + Intergenic
1037598020 8:20370648-20370670 TGGTGCCAGCATGGTGAAAAAGG + Intergenic
1038633739 8:29269045-29269067 TAGGGCCTTGTTTGTGGAAAGGG - Intergenic
1039465377 8:37781740-37781762 TGGTGCAAACTGGGTGGAAAAGG - Intergenic
1040287769 8:46109211-46109233 TGGGGCCTTCTGGATGGAAGAGG + Intergenic
1040288358 8:46111796-46111818 TGGGGGCTTCTTGGTTGGAAGGG + Intergenic
1040958027 8:53000021-53000043 TGTTGTCTTTTTGATGGAAAGGG - Intergenic
1042290873 8:67168122-67168144 TCGTACTTTTTTGGTGGAAACGG - Intronic
1042865502 8:73353458-73353480 TGGTGACCCCTTGGGGGAAAGGG - Intergenic
1044752474 8:95429687-95429709 TGGTGCCTTCCCCATGGAAATGG + Intergenic
1045430136 8:102106039-102106061 ATGTGCCCTCTTGGTGGTAAAGG - Intronic
1047144305 8:122179762-122179784 TGGTGCCTTCTTGCTGTATATGG - Intergenic
1048088747 8:131214685-131214707 TTGTGCCTACTTTGTAGAAAAGG + Intergenic
1048506850 8:135029494-135029516 TGGTTCCTCTTTAGTGGAAAGGG - Intergenic
1051001978 9:12293248-12293270 TGCTGCTTTCTTGGTGGGCAGGG - Intergenic
1051017954 9:12503871-12503893 AGGAGCCTCCTTGGGGGAAAAGG + Intergenic
1051336283 9:16069448-16069470 TGGCGCCTTCTTCGTGCATATGG - Intergenic
1057262079 9:93590705-93590727 TGCAGCCTCCTTGGTGGGAATGG - Intronic
1057885163 9:98824256-98824278 TGGTGGCTCCTTGGTGGATGGGG + Intronic
1062003081 9:134226522-134226544 TGGTGCCTCCTGGCTGGGAAAGG + Intergenic
1185655366 X:1680043-1680065 TGGTATCTTATTGGTAGAAAGGG + Intergenic
1186620942 X:11239523-11239545 TGGAGCCTGTTTGCTGGAAAGGG + Intronic
1188936328 X:36180061-36180083 TGGTGCGTTCATGGTGTTAAAGG - Intergenic
1189008496 X:37019943-37019965 ATCTTCCTTCTTGGTGGAAAAGG - Intergenic
1189040230 X:37535067-37535089 ATCTTCCTTCTTGGTGGAAAAGG + Intronic
1191739613 X:64422941-64422963 TGCTTCCTTCTTGCTGGAAAAGG - Intergenic
1196260700 X:113577100-113577122 TGGTGTGTTTTTGGTGAAAACGG - Intergenic
1200257660 X:154593138-154593160 TGGCTCCTTCTTAGTGGATATGG + Intergenic
1200409610 Y:2848302-2848324 TAGTGCCTTTTTGGTGGGCAAGG + Intronic