ID: 1022943785

View in Genome Browser
Species Human (GRCh38)
Location 7:35262256-35262278
Sequence CGGCCAGCTGCAGCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022943779_1022943785 -10 Left 1022943779 7:35262243-35262265 CCACCGCCGGTCCCGGCCAGCTG No data
Right 1022943785 7:35262256-35262278 CGGCCAGCTGCAGCTTTTCTGGG No data
1022943777_1022943785 -3 Left 1022943777 7:35262236-35262258 CCTGAGGCCACCGCCGGTCCCGG No data
Right 1022943785 7:35262256-35262278 CGGCCAGCTGCAGCTTTTCTGGG No data
1022943766_1022943785 30 Left 1022943766 7:35262203-35262225 CCCCATTAGCACAGGGCAGGCTG No data
Right 1022943785 7:35262256-35262278 CGGCCAGCTGCAGCTTTTCTGGG No data
1022943767_1022943785 29 Left 1022943767 7:35262204-35262226 CCCATTAGCACAGGGCAGGCTGG No data
Right 1022943785 7:35262256-35262278 CGGCCAGCTGCAGCTTTTCTGGG No data
1022943769_1022943785 28 Left 1022943769 7:35262205-35262227 CCATTAGCACAGGGCAGGCTGGG No data
Right 1022943785 7:35262256-35262278 CGGCCAGCTGCAGCTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022943785 Original CRISPR CGGCCAGCTGCAGCTTTTCT GGG Intergenic
No off target data available for this crispr