ID: 1022947174

View in Genome Browser
Species Human (GRCh38)
Location 7:35298531-35298553
Sequence CTGTGTTGCAAAAATGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022947172_1022947174 16 Left 1022947172 7:35298492-35298514 CCTACATGCTAAGTAATAATTTC No data
Right 1022947174 7:35298531-35298553 CTGTGTTGCAAAAATGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022947174 Original CRISPR CTGTGTTGCAAAAATGAAGT TGG Intergenic
No off target data available for this crispr