ID: 1022952743

View in Genome Browser
Species Human (GRCh38)
Location 7:35354061-35354083
Sequence CTGCTTTCCTTTTGCAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022952743_1022952745 -1 Left 1022952743 7:35354061-35354083 CCTGATTTGCAAAAGGAAAGCAG No data
Right 1022952745 7:35354083-35354105 GCTGGAGAGAAGTGCACTCGAGG No data
1022952743_1022952747 15 Left 1022952743 7:35354061-35354083 CCTGATTTGCAAAAGGAAAGCAG No data
Right 1022952747 7:35354099-35354121 CTCGAGGTGGAGACTGATAGTGG No data
1022952743_1022952746 2 Left 1022952743 7:35354061-35354083 CCTGATTTGCAAAAGGAAAGCAG No data
Right 1022952746 7:35354086-35354108 GGAGAGAAGTGCACTCGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022952743 Original CRISPR CTGCTTTCCTTTTGCAAATC AGG (reversed) Intergenic
No off target data available for this crispr