ID: 1022953930

View in Genome Browser
Species Human (GRCh38)
Location 7:35364216-35364238
Sequence GGGATGCTGATGCTTCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022953923_1022953930 10 Left 1022953923 7:35364183-35364205 CCTGAGATGTTGCATTTTCTAAT No data
Right 1022953930 7:35364216-35364238 GGGATGCTGATGCTTCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022953930 Original CRISPR GGGATGCTGATGCTTCTGGT TGG Intergenic
No off target data available for this crispr