ID: 1022955728

View in Genome Browser
Species Human (GRCh38)
Location 7:35378346-35378368
Sequence CTCATCACAGACTTTTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022955728_1022955733 13 Left 1022955728 7:35378346-35378368 CCTGAGCAAAAGTCTGTGATGAG No data
Right 1022955733 7:35378382-35378404 AGGAAAAGCCATTCCATCCTTGG No data
1022955728_1022955730 -7 Left 1022955728 7:35378346-35378368 CCTGAGCAAAAGTCTGTGATGAG No data
Right 1022955730 7:35378362-35378384 TGATGAGGACACTCCCAGTCAGG No data
1022955728_1022955739 26 Left 1022955728 7:35378346-35378368 CCTGAGCAAAAGTCTGTGATGAG No data
Right 1022955739 7:35378395-35378417 CCATCCTTGGCCCACTGTGGGGG No data
1022955728_1022955736 24 Left 1022955728 7:35378346-35378368 CCTGAGCAAAAGTCTGTGATGAG No data
Right 1022955736 7:35378393-35378415 TTCCATCCTTGGCCCACTGTGGG No data
1022955728_1022955737 25 Left 1022955728 7:35378346-35378368 CCTGAGCAAAAGTCTGTGATGAG No data
Right 1022955737 7:35378394-35378416 TCCATCCTTGGCCCACTGTGGGG No data
1022955728_1022955742 30 Left 1022955728 7:35378346-35378368 CCTGAGCAAAAGTCTGTGATGAG No data
Right 1022955742 7:35378399-35378421 CCTTGGCCCACTGTGGGGGTGGG No data
1022955728_1022955735 23 Left 1022955728 7:35378346-35378368 CCTGAGCAAAAGTCTGTGATGAG No data
Right 1022955735 7:35378392-35378414 ATTCCATCCTTGGCCCACTGTGG No data
1022955728_1022955740 29 Left 1022955728 7:35378346-35378368 CCTGAGCAAAAGTCTGTGATGAG No data
Right 1022955740 7:35378398-35378420 TCCTTGGCCCACTGTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022955728 Original CRISPR CTCATCACAGACTTTTGCTC AGG (reversed) Intergenic
No off target data available for this crispr