ID: 1022955731

View in Genome Browser
Species Human (GRCh38)
Location 7:35378375-35378397
Sequence TGGAATGGCTTTTCCTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022955731_1022955739 -3 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955739 7:35378395-35378417 CCATCCTTGGCCCACTGTGGGGG No data
1022955731_1022955747 6 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955747 7:35378404-35378426 GCCCACTGTGGGGGTGGGGGGGG No data
1022955731_1022955742 1 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955742 7:35378399-35378421 CCTTGGCCCACTGTGGGGGTGGG No data
1022955731_1022955735 -6 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955735 7:35378392-35378414 ATTCCATCCTTGGCCCACTGTGG No data
1022955731_1022955743 2 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955743 7:35378400-35378422 CTTGGCCCACTGTGGGGGTGGGG No data
1022955731_1022955745 4 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955745 7:35378402-35378424 TGGCCCACTGTGGGGGTGGGGGG No data
1022955731_1022955737 -4 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955737 7:35378394-35378416 TCCATCCTTGGCCCACTGTGGGG No data
1022955731_1022955740 0 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955740 7:35378398-35378420 TCCTTGGCCCACTGTGGGGGTGG No data
1022955731_1022955736 -5 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955736 7:35378393-35378415 TTCCATCCTTGGCCCACTGTGGG No data
1022955731_1022955744 3 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955744 7:35378401-35378423 TTGGCCCACTGTGGGGGTGGGGG No data
1022955731_1022955746 5 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955746 7:35378403-35378425 GGCCCACTGTGGGGGTGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022955731 Original CRISPR TGGAATGGCTTTTCCTGACT GGG (reversed) Intergenic
No off target data available for this crispr