ID: 1022955740

View in Genome Browser
Species Human (GRCh38)
Location 7:35378398-35378420
Sequence TCCTTGGCCCACTGTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022955728_1022955740 29 Left 1022955728 7:35378346-35378368 CCTGAGCAAAAGTCTGTGATGAG No data
Right 1022955740 7:35378398-35378420 TCCTTGGCCCACTGTGGGGGTGG No data
1022955732_1022955740 -1 Left 1022955732 7:35378376-35378398 CCAGTCAGGAAAAGCCATTCCAT No data
Right 1022955740 7:35378398-35378420 TCCTTGGCCCACTGTGGGGGTGG No data
1022955731_1022955740 0 Left 1022955731 7:35378375-35378397 CCCAGTCAGGAAAAGCCATTCCA No data
Right 1022955740 7:35378398-35378420 TCCTTGGCCCACTGTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022955740 Original CRISPR TCCTTGGCCCACTGTGGGGG TGG Intergenic
No off target data available for this crispr