ID: 1022968153

View in Genome Browser
Species Human (GRCh38)
Location 7:35493352-35493374
Sequence CTTTCCTGGAAAGCCTCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022968153_1022968161 24 Left 1022968153 7:35493352-35493374 CCCAGCGAGGCTTTCCAGGAAAG No data
Right 1022968161 7:35493399-35493421 CTATAAGCAGCAGACAGAATGGG No data
1022968153_1022968160 23 Left 1022968153 7:35493352-35493374 CCCAGCGAGGCTTTCCAGGAAAG No data
Right 1022968160 7:35493398-35493420 ACTATAAGCAGCAGACAGAATGG No data
1022968153_1022968156 -10 Left 1022968153 7:35493352-35493374 CCCAGCGAGGCTTTCCAGGAAAG No data
Right 1022968156 7:35493365-35493387 TCCAGGAAAGAAGTCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022968153 Original CRISPR CTTTCCTGGAAAGCCTCGCT GGG (reversed) Intergenic