ID: 1022972136

View in Genome Browser
Species Human (GRCh38)
Location 7:35528151-35528173
Sequence CTGGAGGCCCAGCTGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022972136_1022972148 19 Left 1022972136 7:35528151-35528173 CCCAGTTCCAGCTGGGCCTCCAG No data
Right 1022972148 7:35528193-35528215 GTAGAGAGAAGCAGATGGTTAGG No data
1022972136_1022972150 24 Left 1022972136 7:35528151-35528173 CCCAGTTCCAGCTGGGCCTCCAG No data
Right 1022972150 7:35528198-35528220 GAGAAGCAGATGGTTAGGGCAGG No data
1022972136_1022972149 20 Left 1022972136 7:35528151-35528173 CCCAGTTCCAGCTGGGCCTCCAG No data
Right 1022972149 7:35528194-35528216 TAGAGAGAAGCAGATGGTTAGGG No data
1022972136_1022972147 14 Left 1022972136 7:35528151-35528173 CCCAGTTCCAGCTGGGCCTCCAG No data
Right 1022972147 7:35528188-35528210 CTTGGGTAGAGAGAAGCAGATGG No data
1022972136_1022972144 -4 Left 1022972136 7:35528151-35528173 CCCAGTTCCAGCTGGGCCTCCAG No data
Right 1022972144 7:35528170-35528192 CCAGGTGACCTGGAGGAGCTTGG No data
1022972136_1022972145 -3 Left 1022972136 7:35528151-35528173 CCCAGTTCCAGCTGGGCCTCCAG No data
Right 1022972145 7:35528171-35528193 CAGGTGACCTGGAGGAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022972136 Original CRISPR CTGGAGGCCCAGCTGGAACT GGG (reversed) Intergenic
No off target data available for this crispr