ID: 1022977243

View in Genome Browser
Species Human (GRCh38)
Location 7:35570065-35570087
Sequence GTAAAATCAAGACTCCGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022977239_1022977243 12 Left 1022977239 7:35570030-35570052 CCTTCATGTCCATGGACTTTCCT No data
Right 1022977243 7:35570065-35570087 GTAAAATCAAGACTCCGGCTTGG No data
1022977240_1022977243 3 Left 1022977240 7:35570039-35570061 CCATGGACTTTCCTTAGATCAAA No data
Right 1022977243 7:35570065-35570087 GTAAAATCAAGACTCCGGCTTGG No data
1022977241_1022977243 -8 Left 1022977241 7:35570050-35570072 CCTTAGATCAAAGCAGTAAAATC No data
Right 1022977243 7:35570065-35570087 GTAAAATCAAGACTCCGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022977243 Original CRISPR GTAAAATCAAGACTCCGGCT TGG Intergenic
No off target data available for this crispr