ID: 1022980364

View in Genome Browser
Species Human (GRCh38)
Location 7:35599897-35599919
Sequence GGATTAAAACTGATGGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022980359_1022980364 2 Left 1022980359 7:35599872-35599894 CCTCCTGCATTAGATGATGTATT No data
Right 1022980364 7:35599897-35599919 GGATTAAAACTGATGGGTCATGG No data
1022980358_1022980364 24 Left 1022980358 7:35599850-35599872 CCATGAAAGGAGAACTAAACTTC No data
Right 1022980364 7:35599897-35599919 GGATTAAAACTGATGGGTCATGG No data
1022980360_1022980364 -1 Left 1022980360 7:35599875-35599897 CCTGCATTAGATGATGTATTAAG No data
Right 1022980364 7:35599897-35599919 GGATTAAAACTGATGGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022980364 Original CRISPR GGATTAAAACTGATGGGTCA TGG Intergenic
No off target data available for this crispr