ID: 1022983739

View in Genome Browser
Species Human (GRCh38)
Location 7:35629100-35629122
Sequence GTGAGCCAGCTGGCCAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022983732_1022983739 11 Left 1022983732 7:35629066-35629088 CCAATGTGCAATGCTAGCAATAC No data
Right 1022983739 7:35629100-35629122 GTGAGCCAGCTGGCCAAATTGGG No data
1022983731_1022983739 24 Left 1022983731 7:35629053-35629075 CCAAGCTGCAGTTCCAATGTGCA No data
Right 1022983739 7:35629100-35629122 GTGAGCCAGCTGGCCAAATTGGG No data
1022983730_1022983739 25 Left 1022983730 7:35629052-35629074 CCCAAGCTGCAGTTCCAATGTGC No data
Right 1022983739 7:35629100-35629122 GTGAGCCAGCTGGCCAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022983739 Original CRISPR GTGAGCCAGCTGGCCAAATT GGG Intergenic
No off target data available for this crispr