ID: 1022989543

View in Genome Browser
Species Human (GRCh38)
Location 7:35694655-35694677
Sequence AGGGCACAACGGCCGGCCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022989529_1022989543 25 Left 1022989529 7:35694607-35694629 CCGTCGTGAGGAGAAAGGAAGCT 0: 1
1: 0
2: 1
3: 17
4: 146
Right 1022989543 7:35694655-35694677 AGGGCACAACGGCCGGCCCGGGG 0: 1
1: 0
2: 0
3: 8
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022989543 Original CRISPR AGGGCACAACGGCCGGCCCG GGG Exonic
900108514 1:996323-996345 AGGGCAGAAAGGCCCCCCCGCGG + Intergenic
902221477 1:14968614-14968636 AGGGCACAGCAGCCAGCACGGGG + Intronic
902338156 1:15765656-15765678 AGGACACAAAGGCTGGCCCCGGG + Intronic
903878213 1:26490803-26490825 GGGGCACAAAGGCAGGCCCGGGG - Intergenic
904482379 1:30802041-30802063 AAGGCACAGAGGCCTGCCCGTGG - Intergenic
1062938909 10:1407382-1407404 AGGGTACAACGGCCGGGGTGGGG + Intronic
1065342865 10:24723324-24723346 AGGGCACAAAGGCCGGCGGTGGG - Intronic
1067688269 10:48480967-48480989 AGGGCACCACAGCGGGCCCGTGG + Intronic
1075754787 10:124802000-124802022 TGGGCACCAGGGCCGGCCGGAGG + Intronic
1077535571 11:3122457-3122479 AGGGCACAGGGGCCGGCCCAGGG + Intronic
1080387924 11:31820400-31820422 AGGGCACCGCGGGCGGCCCGGGG + Intronic
1085059239 11:73429696-73429718 AGGGAACAACGGTCTGCCTGGGG - Intronic
1091548294 12:1518970-1518992 AGGGCAGAACTGCAGGCCCCTGG + Intergenic
1096659523 12:53115619-53115641 AGGACACAACGGGAGGCCGGCGG - Exonic
1101692262 12:107093370-107093392 AAGACAAAACGGCCCGCCCGAGG + Exonic
1101781667 12:107843834-107843856 TGGGCACCACAGCCAGCCCGAGG + Intergenic
1107959226 13:45543852-45543874 AGGACACAACAGCAGGCCTGGGG + Intronic
1113805851 13:113109766-113109788 CGGGCAGCACGGCCGCCCCGGGG + Intronic
1123023159 14:105411598-105411620 AGGGGACAACGGCGGGGCCCGGG - Intronic
1127197948 15:56610339-56610361 AGGGCACAAGTGCCTGCCCAGGG + Intergenic
1129752855 15:78077798-78077820 AGGGGGCAACGGCCGGCGGGCGG - Intronic
1132065528 15:98727816-98727838 AGCGCACCAGGGCCGGCCGGCGG - Intronic
1134441562 16:14302190-14302212 AGCGCCCTATGGCCGGCCCGGGG - Intergenic
1144495891 17:15744541-15744563 AGGGCACACCGGCCTGCATGGGG - Intronic
1144999290 17:19292239-19292261 AGGGCAGCAGGGCCCGCCCGGGG + Intronic
1148909266 17:50931741-50931763 AGCGAACAAGGGCCGGCCTGGGG + Intergenic
1152538945 17:80965237-80965259 ATGGCACCACGGCCGGCACCTGG + Exonic
1154492623 18:14933379-14933401 AGGGGACAGCAGCAGGCCCGGGG + Intergenic
1156489047 18:37485649-37485671 AGGGCGCGTCGGCGGGCCCGGGG - Intronic
1159752944 18:72325350-72325372 AGTGCACAAAGGCCAGCCCCAGG - Intergenic
1160404811 18:78638129-78638151 AGGGCGCCCCGGCCGGCCTGGGG + Intergenic
1161283212 19:3456674-3456696 AGGGCAGAGGGGCCGGCCCGGGG + Intronic
1161959471 19:7515997-7516019 CGGGGACAAAGGCCTGCCCGGGG + Intronic
1162799923 19:13104683-13104705 AGCGCACAGCTGCCGCCCCGTGG + Intergenic
1165074589 19:33273754-33273776 AGGGCCCCAAGGCCAGCCCGGGG + Intergenic
1165775900 19:38404175-38404197 AGCCCACCACGCCCGGCCCGGGG + Intronic
1167101610 19:47407315-47407337 AGGGCCCGCGGGCCGGCCCGGGG - Intronic
926199874 2:10787031-10787053 ATGGCACACAGGGCGGCCCGAGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
946373579 2:219294995-219295017 AGGGCACACCGGCCTCCACGCGG - Exonic
947710169 2:232309007-232309029 AGGGAACAGGGGCAGGCCCGGGG + Intronic
948945554 2:241217479-241217501 AGGGCAGGACAGCCGGCCTGAGG + Intronic
948973434 2:241447490-241447512 AGGACACAAGGCCCGCCCCGTGG - Intronic
1172539752 20:35701877-35701899 AAGGCACCACGTCCAGCCCGAGG + Intergenic
1174743336 20:53038056-53038078 AGGGAACGACAGCCTGCCCGGGG + Intronic
1175834894 20:61987136-61987158 AGGACACGCCAGCCGGCCCGCGG + Intronic
1176377396 21:6093363-6093385 AGGACCCAACAGCAGGCCCGTGG + Intergenic
1179746078 21:43444881-43444903 AGGACCCAACAGCAGGCCCGTGG - Intergenic
1179957672 21:44750301-44750323 AGGACACAGCGCCCGGCCTGAGG - Intergenic
1180064596 21:45405922-45405944 GGCGCACAAGGCCCGGCCCGCGG - Intronic
1181431731 22:22885469-22885491 AGGGCACAAGGGAGGGCCCTGGG - Intronic
1184713882 22:46269205-46269227 AGGCCACAATGGGAGGCCCGGGG - Intronic
1185155311 22:49190154-49190176 ACGGCACAGGAGCCGGCCCGAGG + Intergenic
949896087 3:8768434-8768456 AGGGCACAACCGCCGGCCTCGGG + Intronic
950443301 3:13022317-13022339 AGGGCACAGAGGCTGGCCGGTGG - Intronic
950530383 3:13549430-13549452 CGGGCACAGAGGCCGGCGCGGGG + Intronic
954613045 3:51956265-51956287 AGGCCCCCACGGCCGGCGCGCGG + Exonic
985666391 5:1183610-1183632 AGGACACCAGGGCCGGCCCCAGG + Intergenic
991371729 5:65926127-65926149 ACGGCCCGACGGACGGCCCGGGG + Intergenic
1003113764 6:3269793-3269815 AGGTCACACCGCCCGGCCCGAGG - Exonic
1003290386 6:4775353-4775375 AGGGCACACCTGCCGGGCCCTGG - Intronic
1005915204 6:30345292-30345314 AGGACACAATGGGCGGCCTGCGG - Exonic
1007414670 6:41684557-41684579 AGGGAACAGGGGCCGGCCTGGGG - Exonic
1019758754 7:2793039-2793061 AGGGCTCAACGGCACGCCTGCGG + Intronic
1020112162 7:5453448-5453470 AGGGGAGGAGGGCCGGCCCGAGG - Intronic
1022989543 7:35694655-35694677 AGGGCACAACGGCCGGCCCGGGG + Exonic
1023959271 7:44913077-44913099 AGGGCAGAATGGCCAGGCCGAGG + Intergenic
1048456790 8:134585606-134585628 AGGGTTCCACAGCCGGCCCGTGG - Intronic
1056807932 9:89743289-89743311 AGGCCACAACGACCCGGCCGCGG - Intergenic
1062435641 9:136545589-136545611 AGGGAAAAGCGGGCGGCCCGGGG - Intronic
1062701316 9:137905894-137905916 AGGGCACAAGGGCAGGTCCGAGG - Intronic
1190829031 X:54044115-54044137 AGGCCCGAACGGCCGGGCCGAGG - Intronic
1192563201 X:72140928-72140950 AGGGCAGTAAGGCCAGCCCGTGG - Exonic