ID: 1022989913

View in Genome Browser
Species Human (GRCh38)
Location 7:35696639-35696661
Sequence CGGCAGACAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022989913_1022989921 24 Left 1022989913 7:35696639-35696661 CCGTCCACCACTGCTGTCTGCCG No data
Right 1022989921 7:35696686-35696708 CCATCCCTCTGGATCCAGCGAGG No data
1022989913_1022989919 13 Left 1022989913 7:35696639-35696661 CCGTCCACCACTGCTGTCTGCCG No data
Right 1022989919 7:35696675-35696697 ACAGCTGACTTCCATCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022989913 Original CRISPR CGGCAGACAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr