ID: 1022997769

View in Genome Browser
Species Human (GRCh38)
Location 7:35775329-35775351
Sequence TCAGTGGCCATCTGTTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022997765_1022997769 5 Left 1022997765 7:35775301-35775323 CCCTGCATGCACACACAAGCATC No data
Right 1022997769 7:35775329-35775351 TCAGTGGCCATCTGTTGAGGTGG No data
1022997766_1022997769 4 Left 1022997766 7:35775302-35775324 CCTGCATGCACACACAAGCATCT No data
Right 1022997769 7:35775329-35775351 TCAGTGGCCATCTGTTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022997769 Original CRISPR TCAGTGGCCATCTGTTGAGG TGG Intergenic
No off target data available for this crispr