ID: 1023000314

View in Genome Browser
Species Human (GRCh38)
Location 7:35801414-35801436
Sequence GCCCGGGGCGCGGCAGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 5, 3: 77, 4: 615}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023000306_1023000314 -2 Left 1023000306 7:35801393-35801415 CCGGGATGGGGGCCACTGCGGGC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG 0: 1
1: 0
2: 5
3: 77
4: 615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023000314 Original CRISPR GCCCGGGGCGCGGCAGCGGC GGG Intronic
900191659 1:1354686-1354708 GCCTGGGGCGCCGCTGTGGCTGG + Exonic
900322284 1:2090711-2090733 GCCCTGGGAGCGGCAGCCGGGGG + Intronic
900513270 1:3070099-3070121 GGCCCGAGGGCGGCAGCGGCGGG - Intronic
900671299 1:3856808-3856830 GCGCGGGGCGCGGGCGCCGCGGG - Intronic
900970966 1:5992256-5992278 GCCTCCGGCGCGGCCGCGGCGGG - Exonic
901051559 1:6428171-6428193 GCCAGGGGCGGGGCAGCAACAGG + Intronic
901109773 1:6785440-6785462 GGCGGGTGCGCGGCGGCGGCGGG + Exonic
901110004 1:6786045-6786067 CCCCGTCGGGCGGCAGCGGCCGG + Intronic
901332816 1:8423881-8423903 GCCGGGGGCGGGGCCGGGGCCGG - Intronic
901433922 1:9234815-9234837 GCCTGGGGCGGGGTGGCGGCCGG + Exonic
901433999 1:9235086-9235108 GCCGGGGCCGGGGCGGCGGCGGG - Intronic
901443416 1:9292995-9293017 GCCCGGGCCGCGCCCGCCGCAGG - Exonic
901526055 1:9824005-9824027 GCCGGGGGCGGGGTGGCGGCGGG + Exonic
901577209 1:10210643-10210665 GGCCAGGGCGCGGCGACGGCCGG - Intergenic
902369261 1:15995140-15995162 GCCGGGGGCGCTGGAGGGGCTGG - Intergenic
902482761 1:16720190-16720212 GCCAGGGGCGGGGCAGCAACAGG - Intergenic
902607382 1:17576191-17576213 GCCCGGGGTGGGACAGGGGCAGG + Intronic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
903069096 1:20717820-20717842 GGCAGGGGCGGGGCCGCGGCGGG + Exonic
903153316 1:21428306-21428328 GGCGGCGGCGCGCCAGCGGCAGG + Intergenic
903164139 1:21509297-21509319 GCCGGGGGCGGGGCCGGGGCCGG + Intergenic
903193566 1:21669430-21669452 GCCGCGGGCGCGGGAGCGGCGGG + Intergenic
903750177 1:25616686-25616708 GGCTGCGGCGCGGCGGCGGCGGG + Intergenic
903750211 1:25616798-25616820 GCCCGAGCGGCGGCGGCGGCGGG + Intergenic
903839117 1:26225653-26225675 GCCTGGAGCGCGGCGGCAGCTGG + Intergenic
903883720 1:26529630-26529652 CCTCGGGGCGCGGCGGGGGCGGG + Intergenic
903907706 1:26697491-26697513 GCCCCGGGAGCAGCGGCGGCGGG + Exonic
904039472 1:27575740-27575762 GCCCGGGGCGCGGGAAGGGGCGG - Intronic
904080973 1:27872480-27872502 GTGCGGGGCGGGGCATCGGCGGG + Intergenic
904199783 1:28812262-28812284 GGCCGGGGCGCGGCAGCCGGCGG + Exonic
904237363 1:29123932-29123954 GGCCGGGGCGGGGCTGGGGCCGG - Intronic
904478124 1:30777502-30777524 GCCCAGGGCAGGGCAGGGGCCGG + Intergenic
904500117 1:30908516-30908538 GCCGGGGCCGGGGCCGCGGCCGG - Exonic
904533138 1:31182103-31182125 GCCTGGGGCGGGGCTTCGGCTGG + Intronic
904563337 1:31413161-31413183 GGCCGGGGCGGGGCCGGGGCCGG + Intronic
904782963 1:32964465-32964487 CCCTGGGCCGCGGCAGGGGCCGG + Exonic
904782989 1:32964536-32964558 GGCCCGGGCGCGGCGGCCGCGGG + Exonic
905167158 1:36089322-36089344 GCTCGGGGCGTGGCAGCACCGGG + Intronic
905308405 1:37034129-37034151 GCCCGGGGCGCGGCCGTGGCGGG + Intronic
905648271 1:39639687-39639709 GGCCGGGGCGGGGCCGGGGCGGG - Exonic
906211502 1:44014724-44014746 GCCCTGGGCTTGGCAGAGGCGGG + Intronic
907277665 1:53326273-53326295 GGCCGGGGCGGGGCCGGGGCAGG + Intronic
907450464 1:54542663-54542685 GCCCGGCGCGCCGCAGAGGCTGG + Intronic
908555697 1:65254689-65254711 GGCAGGGGCGCAGCGGCGGCGGG + Intronic
908561287 1:65309439-65309461 GCCCGGAGCTCGGCAGGGCCGGG + Intronic
910427526 1:87131940-87131962 GCCCGAGGCGCGGTCGCAGCCGG + Intronic
910449035 1:87328656-87328678 GCCCCGGGAGCGGCGGCGGACGG - Exonic
910449523 1:87331553-87331575 TCCCGGGGCCCGGCGGGGGCTGG + Intronic
910569612 1:88684711-88684733 GCTAGGGGCGCGGCGGCCGCAGG - Intronic
910788131 1:91022147-91022169 GCCCGCAGCCCGGCAGAGGCGGG - Exonic
911078991 1:93909505-93909527 TCCCGCGGCGGGGCAGGGGCGGG + Intergenic
911144709 1:94541491-94541513 GCCCGGGGCGCGCCACACGCAGG - Intronic
914758458 1:150579764-150579786 GGCCGGGGCGGGGCCGGGGCCGG + Intergenic
914919548 1:151838233-151838255 TCCCGGGGCGGGACCGCGGCCGG + Exonic
915143993 1:153783817-153783839 GCCCGGCGCGCGAGAGGGGCGGG + Intergenic
915246309 1:154558499-154558521 GCCGGGGCCGGGGCAGCAGCTGG - Exonic
915325269 1:155078768-155078790 GTCGGGGGCGCGCCAGGGGCGGG + Intergenic
915476120 1:156153850-156153872 GGCCGGGGAGCTGCAGAGGCTGG + Intronic
916651688 1:166839661-166839683 GGCTGGGCCGCGGCAGAGGCGGG + Intronic
917141615 1:171841400-171841422 GCCCGGGGCGGGGCAGCCGCGGG + Intergenic
918001642 1:180502597-180502619 GCGCGGGGCGCGGCTGGCGCTGG + Exonic
918015981 1:180632522-180632544 GCCCGGGCCGGGGCCGGGGCCGG + Intronic
918265672 1:182839548-182839570 GCGCGGGCGGCGGCGGCGGCTGG + Intronic
918388654 1:184036619-184036641 GCCAGGGGCTCCGCAGTGGCTGG - Intronic
918423710 1:184387531-184387553 GCCCGGGCCGGGGCTGCTGCTGG + Intronic
919748624 1:201023468-201023490 GGCGGGGGCGCGGGCGCGGCTGG + Exonic
920511803 1:206557314-206557336 GCCCGGGGCTCTGCAGGCGCAGG + Intronic
921472674 1:215567569-215567591 GCCAGCGGGGCGGCGGCGGCCGG - Exonic
922141755 1:222894479-222894501 GCCCGGGTTGCGACAGCGCCTGG + Intronic
922440647 1:225653018-225653040 GCCGGGCGCGCGGCCCCGGCGGG - Exonic
922739366 1:228006871-228006893 GCCCGGGCCCCGGCCCCGGCGGG + Intergenic
922765881 1:228156646-228156668 GCCTGGGAGGCAGCAGCGGCAGG - Intronic
922851393 1:228736106-228736128 GCCCCGGGCGCGGCTCCAGCTGG + Intronic
923386103 1:233466305-233466327 GCCAGGGCAGGGGCAGCGGCAGG - Intergenic
923462136 1:234216584-234216606 GCCCGTGGCGAGGCAGCTGCTGG - Intronic
924853896 1:247857261-247857283 GCCCGGGGAGCGGCTGCGCGAGG + Exonic
1062857105 10:784839-784861 GCCCCGGGCGCTGCGGGGGCGGG - Intergenic
1062911767 10:1216340-1216362 GCTTGGGGCGTGGCAGCGACTGG + Intronic
1063362535 10:5469836-5469858 GCCCGGTGGGCGGCAGAGCCAGG + Intergenic
1063664501 10:8053436-8053458 GCCCGGGTGGCTGCAGCCGCTGG - Intergenic
1064086492 10:12349584-12349606 AGCCGGCGCGCGGCGGCGGCAGG + Exonic
1064582711 10:16810459-16810481 GCCCGGGGGGCGGCTGCTGGGGG - Intronic
1064622507 10:17229644-17229666 GCCCGGGGTGCGGCTCCTGCAGG + Exonic
1065020333 10:21497015-21497037 GGCCGGGGCGCGGCTGCACCGGG - Exonic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1065289468 10:24215271-24215293 GCCCTGGGCTCTGCAGAGGCTGG + Intronic
1065549943 10:26860466-26860488 CGCCGGGCTGCGGCAGCGGCGGG + Intronic
1066080625 10:31928138-31928160 GCCCAGGGCGCGGGAGGGGCCGG + Intronic
1066429474 10:35337350-35337372 GCCCGGGGCCCCGCAGCCTCTGG + Intronic
1066464217 10:35639480-35639502 GGCCGGGGGGCGGCGGCGGCGGG - Exonic
1067521832 10:47013675-47013697 GTCCGGGGCGCTGCAGGGCCAGG - Intergenic
1067853291 10:49768926-49768948 CAGCGGGGCGCGGCCGCGGCAGG - Intergenic
1072700942 10:97640935-97640957 GCCCGGGGCGCGGCGGCCCAGGG + Exonic
1072915483 10:99535283-99535305 CCACGCGGCGCGGCGGCGGCGGG - Exonic
1073082081 10:100866737-100866759 CCCGGGCGGGCGGCAGCGGCAGG - Intergenic
1073379443 10:103066586-103066608 CCCAGGGTGGCGGCAGCGGCCGG - Intronic
1074065363 10:110008226-110008248 GCCCGGGCTGCAGCAGCCGCCGG - Exonic
1074085709 10:110207890-110207912 GGCTGGGGCGCGGCCACGGCGGG - Exonic
1074377386 10:112951300-112951322 GCCCGGGGGGCGGCTCCGGGCGG - Intronic
1074618589 10:115093818-115093840 GGCCGGCGGGCGGCGGCGGCGGG + Exonic
1074753597 10:116609192-116609214 CCCCGGGAGGCGGCCGCGGCAGG - Intergenic
1075105309 10:119536389-119536411 GCCCTGGGCGGGGCAGGGGCTGG - Intronic
1076035550 10:127196277-127196299 GCGCGCGGGGAGGCAGCGGCTGG + Intronic
1076053541 10:127353283-127353305 GCCCTGGCCGCAGCAGCTGCTGG + Intronic
1076550989 10:131278074-131278096 GCCCGGGGGGAGGCAGGAGCCGG - Intronic
1076707001 10:132307700-132307722 GCCCGGGGCTGGCCAGCAGCGGG + Exonic
1076707092 10:132307983-132308005 GCTGGGGGCGGGGCAGGGGCGGG + Intronic
1076707142 10:132308116-132308138 GCCGGGGGCGGGGCAGGGGCGGG + Intronic
1076722036 10:132397013-132397035 TCCCGGGACGCGGCGGCGGCGGG + Intergenic
1076749991 10:132537746-132537768 GCCCGGGGCGGGGCCTGGGCGGG - Intergenic
1076853529 10:133104495-133104517 GCCCGGGGCTCGGCACTGACCGG + Intronic
1076858425 10:133128470-133128492 GCCCGAGGAGCAGCGGCGGCTGG + Exonic
1076861508 10:133140250-133140272 GGCAGGGGCGGGGCAGGGGCGGG - Intergenic
1076861514 10:133140261-133140283 GGCAGGGGCGGGGCAGGGGCGGG - Intergenic
1077043678 11:535320-535342 GCCGGGGGCGCGGGGCCGGCGGG - Intronic
1077043738 11:535459-535481 GGCCGGGGCGGGGCGGGGGCGGG + Exonic
1077081457 11:726259-726281 GGCAGGGGCAAGGCAGCGGCGGG + Intronic
1077103659 11:832890-832912 GGCCGGGGCGGGGCCGGGGCGGG + Exonic
1077121511 11:910959-910981 GGCCGGGGCGGGGCCGCGCCGGG + Intronic
1077141414 11:1026522-1026544 GCCCAGGGCTGGGCAGCAGCTGG - Intronic
1077211061 11:1371158-1371180 ACCCAGGGCTGGGCAGCGGCGGG + Intergenic
1077273476 11:1692626-1692648 CCCCGGGGAGGGGCAGGGGCTGG + Intergenic
1077351426 11:2094938-2094960 GCCTGGGGAGGGACAGCGGCAGG - Intergenic
1077368995 11:2172830-2172852 TCCCTGGGTGGGGCAGCGGCTGG - Intergenic
1077886258 11:6390305-6390327 GCCCGGGGCAGGGCGGGGGCAGG + Intergenic
1078091676 11:8268200-8268222 GCCCGGGCTTCGGCGGCGGCGGG - Intronic
1078146820 11:8727347-8727369 GCTTGGGGCGGGGCAGGGGCAGG - Intronic
1079071489 11:17351702-17351724 GCCCGGGGGCGGGCACCGGCCGG - Intergenic
1079122589 11:17696141-17696163 GCGCGGGGTGCGGCTGCGGGCGG + Intergenic
1081492583 11:43579621-43579643 CCCCGCGCCGCGGCGGCGGCGGG + Intronic
1081831922 11:46121567-46121589 GCCCGGCTCTCGGGAGCGGCGGG - Intergenic
1082983420 11:59144939-59144961 GTCACGGGCGCGGCCGCGGCGGG + Exonic
1083033472 11:59615459-59615481 GCCGGGGGAGTGGCGGCGGCTGG - Exonic
1083316316 11:61816765-61816787 GCCCGGCGCGCGGCGTCGCCAGG - Exonic
1083610217 11:64000764-64000786 GCCCGGGCGGAGGCAGCGACTGG - Intronic
1083849007 11:65354698-65354720 GGCCGGGGCGGGGCTGCGGCGGG + Intergenic
1083950603 11:65953579-65953601 GGCCTGGGAGCGGCAGCGGCAGG + Exonic
1083997219 11:66278414-66278436 GCCCGGGGGGCGCCAGCGCGGGG - Exonic
1084204405 11:67583671-67583693 GCCCGGGGTGCAGCGGCCGCCGG + Exonic
1084295765 11:68212961-68212983 GCGGGGGGCGGGGCTGCGGCCGG - Intronic
1084546785 11:69818684-69818706 CCCCGGGGCCCCGCAGCGTCCGG + Intronic
1084693439 11:70740003-70740025 ACCAGGGGCCCGGCAGGGGCAGG + Intronic
1085197941 11:74683556-74683578 GCCTGGGCCGCGGGGGCGGCGGG - Intergenic
1085208148 11:74749316-74749338 GACGGGGGCGCGGCTGCCGCGGG + Exonic
1089533847 11:119149208-119149230 GGCCGGGGCGGGGCCGGGGCGGG - Exonic
1089566122 11:119372719-119372741 TCCCGGGGAGCTGGAGCGGCTGG + Exonic
1090037504 11:123261687-123261709 GCCCGGGGACCGGCAGACGCCGG - Intergenic
1090285568 11:125496177-125496199 CCACGGGCCGCGGGAGCGGCCGG + Exonic
1090456524 11:126855025-126855047 GCCCAGGGCAGGGCAGAGGCAGG + Intronic
1090662215 11:128890663-128890685 CCCCGGCGTGCGGCGGCGGCTGG - Intergenic
1090699073 11:129278912-129278934 GCGCGGGGCGCGGGCGCGGGAGG + Intronic
1091474046 12:753977-753999 TCCCCAGGGGCGGCAGCGGCTGG - Exonic
1091558627 12:1594287-1594309 GCCCGGGGCGGGGGAGGGCCGGG - Intronic
1091888075 12:4031261-4031283 GCCCCGGGCGGGGGCGCGGCGGG - Intergenic
1092142036 12:6190846-6190868 GCGCAGGGCGCGGCACTGGCAGG - Intergenic
1092184833 12:6471027-6471049 GCGCGGGGTGGGGCAGGGGCGGG - Intergenic
1092228921 12:6766349-6766371 TTCCCGGGGGCGGCAGCGGCTGG + Intronic
1093465030 12:19440070-19440092 GCCTGGTGGGCAGCAGCGGCGGG + Exonic
1094624171 12:32107010-32107032 GCCCGGGCTGCGGCGGCCGCGGG - Intronic
1094704035 12:32897103-32897125 GAGCGGGGCGCGGCCCCGGCAGG - Intergenic
1095812177 12:46383238-46383260 GCCTGGGGCGCTGCAGCGGGCGG + Intergenic
1096647594 12:53047191-53047213 GCGCGGGGCGCGGCGGGGGCGGG + Intronic
1096647753 12:53047667-53047689 GCCCGGGACCCGGCAGCAGCTGG + Intronic
1096674923 12:53221212-53221234 GCCCGGGCCGCGGCGGAGGGCGG - Intronic
1096784414 12:54009056-54009078 GCGCGGGCGGCGGCGGCGGCGGG - Intronic
1097007866 12:55931951-55931973 GCGCCGGGCGCGGGCGCGGCGGG + Intronic
1097155059 12:57006404-57006426 GCTCGGGGCGCCGCAGAGCCGGG - Exonic
1097172901 12:57127731-57127753 GCCCTAGGCGCGGGAGGGGCAGG - Intronic
1097267761 12:57755626-57755648 GCCGGGGAGGCGGCTGCGGCTGG + Exonic
1097981750 12:65742553-65742575 GCGCGTGGCCCGGCCGCGGCGGG - Intergenic
1101371950 12:104138319-104138341 GGGCGGGGCGGGGCCGCGGCGGG - Intergenic
1101421646 12:104555875-104555897 GCCCGGAGAGCAGCAGGGGCTGG - Intronic
1102197715 12:111036313-111036335 GCCCGGGGAGAGGCAGGGGCTGG + Intronic
1102253992 12:111405851-111405873 GACAGGGGCGGGGCAGGGGCGGG - Intergenic
1102644636 12:114396184-114396206 GCCCGGGGTCGGGCAGCCGCGGG - Intronic
1102997452 12:117361215-117361237 ACCCGGAGCGCGGCGGCCGCGGG - Intronic
1103595597 12:122022708-122022730 GCCCGGGAGGCGGGAGCGGGCGG - Intronic
1103764743 12:123271917-123271939 GCGCGGGGCGCGGCCGCAGGCGG - Exonic
1104001637 12:124863976-124863998 GCCCGGGGCGGGGTCGGGGCGGG + Intronic
1105000613 12:132687709-132687731 GCTCGGGGCGCTGCCGCGGCGGG + Exonic
1105441132 13:20416054-20416076 GGCCGGGGCGCCGCAGTGACGGG - Intronic
1105943643 13:25171587-25171609 GCCGGAGCCGCGGCGGCGGCGGG - Exonic
1106157515 13:27171840-27171862 GCCGGGGGCGGGCCGGCGGCCGG - Exonic
1106303905 13:28494307-28494329 GCCCGGGGCTGGGCTGAGGCCGG - Intronic
1106735835 13:32586913-32586935 GCCGGGGCGGCGGCGGCGGCGGG + Intronic
1107371635 13:39756743-39756765 GGGCGGGGGGCGGCAGTGGCGGG + Intronic
1107605213 13:42049163-42049185 GCCTGGGGCGCGGGCGGGGCGGG + Intronic
1109998907 13:70168512-70168534 GCGTGGGGCGGGGCAGTGGCAGG - Intergenic
1110497845 13:76190199-76190221 GCCCCGTCCGCGGCACCGGCTGG - Intergenic
1111268936 13:85854422-85854444 GCCCTGTGCGAGGCTGCGGCTGG - Intergenic
1113379215 13:109787017-109787039 GCGCCGGGCGGGGCCGCGGCTGG + Intergenic
1114069830 14:19097905-19097927 GCCCGGGTGGGGGTAGCGGCAGG + Intergenic
1114092431 14:19302097-19302119 GCCCGGGTGGGGGTAGCGGCAGG - Intergenic
1114187459 14:20413537-20413559 GGGCGGGGCGCAGCAGCTGCTGG + Intergenic
1115651212 14:35404126-35404148 GCCGGGGGCGGGGCGGCAGCGGG - Intronic
1116821848 14:49634437-49634459 GCCCGGGGCCCGGGGGCTGCCGG + Exonic
1116849475 14:49893515-49893537 GCCCGGGTGGCGGCGGCGACTGG + Exonic
1117392007 14:55271502-55271524 GCCCCGGGCCAGGCCGCGGCCGG + Exonic
1118312582 14:64704631-64704653 GCCCGCGTCGCGGCAGCACCTGG + Exonic
1118925697 14:70188499-70188521 GCCCCGGACGCGGCTGCGGCCGG - Exonic
1119793640 14:77376769-77376791 GCCCGGGTGGTGGCAGCGGCGGG + Intronic
1121101537 14:91253473-91253495 GCGGGAGACGCGGCAGCGGCCGG - Intronic
1121617066 14:95320104-95320126 GGGCGGGGCGGGGCAGGGGCGGG + Intergenic
1121796678 14:96741687-96741709 GCCCGGGCTGCAGCAGAGGCTGG + Intergenic
1121803858 14:96797492-96797514 GCCGGGGGCGCGGAGGCGGGCGG + Intronic
1122505468 14:102229118-102229140 GCGCGGGCCGCGGGTGCGGCAGG + Exonic
1122543351 14:102509660-102509682 GCTCAGAGCGCGGCTGCGGCGGG - Exonic
1122544846 14:102516754-102516776 GCCCGAGGCGGGGAAGGGGCCGG + Intergenic
1122779156 14:104136365-104136387 GTGCGGGGCGCGGCGGCGGCGGG + Intergenic
1122913117 14:104843434-104843456 GGCCGGGGCCCTGCAGGGGCAGG + Intergenic
1123025861 14:105423617-105423639 GCCCGCGGCCCTGCAGGGGCAGG - Intronic
1123041296 14:105491325-105491347 CCCCGGGCCGCGGCGGAGGCGGG + Exonic
1123464708 15:20506458-20506480 GCCCGGAGCGCCGCGGCGGGTGG + Intergenic
1123684418 15:22786912-22786934 GCCCGGGTCGGGGCAGGGGACGG + Intronic
1124248870 15:28094842-28094864 GCCCTGGGCACGGCTGCGGGAGG - Intronic
1124629160 15:31327284-31327306 GCACGGGCCGCGGGAGGGGCCGG + Exonic
1124790127 15:32718896-32718918 GCGCGGGGCGGGGAAGAGGCTGG - Intronic
1125674162 15:41493784-41493806 GCGGGGGGCGCGGCCGAGGCGGG + Intronic
1125862001 15:43008362-43008384 GCCGGGGCCGCGGCAGCGCCTGG - Intronic
1127225145 15:56919545-56919567 GCGCCGGGCCCGGCCGCGGCTGG - Intronic
1127342906 15:58065892-58065914 GGCCGGGGGGCGGGAGCGCCGGG - Exonic
1127763575 15:62164451-62164473 GCGCAGGAGGCGGCAGCGGCGGG + Exonic
1127982697 15:64046314-64046336 GCCGCGGTCGCGGCCGCGGCAGG + Intronic
1129144333 15:73633365-73633387 GGCCTGGGCGCTGCGGCGGCAGG - Exonic
1129410570 15:75348288-75348310 GCCTGGCGCGGGGGAGCGGCGGG - Intronic
1129744482 15:78008383-78008405 GGCATGGGTGCGGCAGCGGCAGG + Intronic
1131131592 15:89903927-89903949 GCCCGAGGCGCTGAAGGGGCTGG - Exonic
1131827172 15:96331169-96331191 GCCCGGGCCGCCGCTGCCGCCGG - Exonic
1132055863 15:98649777-98649799 CCCCCGGGCTCGGGAGCGGCGGG + Intronic
1132519791 16:381867-381889 GCCCGGGCGGCGGCGGGGGCCGG - Exonic
1132522493 16:397929-397951 GCCTGGGGCTCTGCTGCGGCTGG - Intronic
1132585992 16:705953-705975 GGCCGGGGCGGGGCGGGGGCGGG - Intronic
1132648653 16:1010542-1010564 GGCCGGGCAGAGGCAGCGGCGGG + Intergenic
1132675679 16:1120418-1120440 GCCCCGGGGCCGGCAGAGGCCGG - Intergenic
1132694354 16:1195302-1195324 GCTCAGGGCGGGGCAGGGGCGGG + Intronic
1132741367 16:1414827-1414849 GCCGGGGGCGGGGCTGCGGGGGG - Intergenic
1132834052 16:1943494-1943516 GCGCGAGGGGCGGCAGGGGCGGG - Intergenic
1132838153 16:1964984-1965006 TCCCGGGCCGCGGCTGGGGCCGG - Intergenic
1132851431 16:2026731-2026753 GCCCGAGGCGGGGCAGGGGGAGG - Intronic
1132877942 16:2148602-2148624 GCCCGTGGAGCGGCGGGGGCGGG + Exonic
1132893235 16:2214787-2214809 GGCCGGCGGGCGGCGGCGGCCGG - Exonic
1132987868 16:2777342-2777364 GCACGGGGCGGGGCTGCGCCGGG - Intergenic
1133026066 16:2989477-2989499 GCCCGGGGTGCTGGAGCAGCTGG - Intergenic
1133097683 16:3458315-3458337 GCCGGGGGCGCGGGCGCGGCCGG - Intronic
1133219922 16:4315650-4315672 GCCGGGGGCGGGGCCGCGGGGGG + Intronic
1133220200 16:4316357-4316379 GCCCGGGGCGCGGACGCGAGCGG - Intronic
1133259256 16:4538001-4538023 CCGCGGGGCTCGGCAGGGGCTGG + Intronic
1133784300 16:8963179-8963201 GCCCGAGGGCCGGCCGCGGCGGG - Intronic
1134539935 16:15056037-15056059 GCCCGAGGGGCGGGGGCGGCGGG - Exonic
1135577330 16:23596029-23596051 ATCCGGGGCGCGCCAGCTGCAGG - Intronic
1136498821 16:30659633-30659655 GCCCGGGGCGCGTCGCCGCCTGG - Exonic
1136576314 16:31127389-31127411 GCCCGGTGAGAGGCAGAGGCAGG + Intronic
1138105884 16:54286948-54286970 GGGCGGGGCGGGGCAGGGGCGGG + Intergenic
1139385496 16:66566463-66566485 ACCAGTGCCGCGGCAGCGGCTGG - Exonic
1139546741 16:67653200-67653222 GCTGGCGGCGCGGCCGCGGCCGG - Exonic
1139664510 16:68447086-68447108 GCGGGGGGCGCGGCCGCGGAGGG - Intronic
1139917799 16:70438990-70439012 GCGCGGGCGGCGGCGGCGGCCGG - Intronic
1140124403 16:72107793-72107815 GCCCAAGGTGGGGCAGCGGCTGG + Exonic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1140927571 16:79599175-79599197 GGCGGGGGCGCGGCGGGGGCGGG - Exonic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1142395420 16:89828800-89828822 GCCGGGGGCGGGGCAGCCGGCGG + Intronic
1142421356 16:89972512-89972534 GGCAGGGGCGCGGCGCCGGCTGG - Exonic
1142586850 17:979420-979442 GCCCGAGCCGCGGCGGCGCCTGG - Exonic
1142763881 17:2055541-2055563 GCTCGGGGCCTGGCAGCGGCGGG + Intronic
1142876316 17:2853718-2853740 GCTCGGGGCGCGGCCCGGGCCGG - Intronic
1143167304 17:4903256-4903278 GGCTGGGGCGGGGCAGGGGCAGG - Intergenic
1143747274 17:9003595-9003617 GCCCGGGGCGCGGGCGCGGCAGG - Intergenic
1143830304 17:9645685-9645707 GCGCAGGGAGCGGCGGCGGCGGG - Exonic
1144787479 17:17840125-17840147 GCGCGGGCCAGGGCAGCGGCTGG + Intergenic
1145077409 17:19867494-19867516 GCCCGGAGCGCGCCAGCGTGCGG + Exonic
1145970957 17:28956221-28956243 GGCGGGGGCGGGGCAGCTGCAGG + Exonic
1146022648 17:29292929-29292951 GCAGGGGGCGAGGCTGCGGCCGG + Intronic
1146439025 17:32877243-32877265 GCCAGGGCCGCGGCTGGGGCGGG - Intergenic
1146445219 17:32927909-32927931 GCCCGGGGCGGGGCGCAGGCAGG + Intronic
1146716293 17:35089319-35089341 GCGCGGAGGGCGGGAGCGGCCGG - Exonic
1146895184 17:36535485-36535507 GCGCGGGAGGCGGAAGCGGCTGG + Intronic
1147312966 17:39605907-39605929 GCCCGAGCCGTGGAAGCGGCCGG + Exonic
1147382211 17:40062766-40062788 TCCCGGGGCGCGGCAGGGGGCGG + Intronic
1147442176 17:40453954-40453976 GCACCGGGCGCTGGAGCGGCTGG + Exonic
1147508766 17:41047181-41047203 GCAGGGGTCGCGGCAGCAGCAGG + Exonic
1147509505 17:41055125-41055147 GCAGGGGTCGCGGCAGCAGCAGG + Exonic
1147510013 17:41059964-41059986 GCAGGGGTCGCGGCAGCAGCAGG + Exonic
1147510606 17:41065759-41065781 GCAGGGGTCGCGGCAGCAGCAGG + Exonic
1147648907 17:42050783-42050805 GCGCGTGGGGCGGCAGGGGCTGG - Intronic
1147700054 17:42388214-42388236 CCCGGGGGCTCCGCAGCGGCAGG - Intronic
1147758270 17:42782142-42782164 GCCTGGGGCGCGGCACTGGCAGG - Intronic
1147970896 17:44218858-44218880 GCCCGGGAGGGGGGAGCGGCGGG - Intronic
1147994714 17:44354420-44354442 GCCCGGGGGGCGAGGGCGGCGGG - Exonic
1148048645 17:44758885-44758907 GCCCGGGCCGCCGCCGCGGCAGG - Intergenic
1148111125 17:45145015-45145037 GCCCAGGTGGTGGCAGCGGCGGG - Intergenic
1148122767 17:45222295-45222317 GGCAGGGGCGCGGCAGGGGCTGG + Intronic
1148782514 17:50129892-50129914 GCCTGGCGGGCGGCAGGGGCGGG - Intergenic
1148930081 17:51120763-51120785 GCCCGGGCCGGGGCTGGGGCTGG + Exonic
1150643449 17:66964574-66964596 ACCCGGAGCGCGGCGGCGGCGGG + Intergenic
1151352720 17:73541225-73541247 GCCCGGGGGGCTGCAGGGGATGG + Intronic
1151508285 17:74543345-74543367 GCCCTGGGCACAGCAGTGGCTGG + Intronic
1151509786 17:74551131-74551153 GCCCTGGGCATGGCAGTGGCTGG + Intergenic
1152183620 17:78840645-78840667 GCCTGGGGCGCGGGAAGGGCTGG - Exonic
1152627292 17:81393576-81393598 GCCAGGGGCTCGGCCGCGGGGGG + Intergenic
1152704060 17:81833695-81833717 GCCCTGGGCGCGGGGGCGGGCGG + Exonic
1152744268 17:82031853-82031875 GCTCGGGGCGCAGCCGGGGCGGG + Intronic
1152754675 17:82082278-82082300 GCCCAGAGCCCGGCAGAGGCGGG + Intronic
1153201971 18:2656024-2656046 GCCCTGAGCCCGGCGGCGGCAGG + Exonic
1153855128 18:9137296-9137318 GCGCGGGGCGGGGCGGGGGCCGG + Intronic
1154349011 18:13567453-13567475 TCCTGGGGGGCTGCAGCGGCGGG - Intronic
1155257872 18:24014487-24014509 GGCCGGGGCGCGGGGGCTGCAGG + Intronic
1155344202 18:24842623-24842645 GCTCGGGGAGCAGCAGTGGCAGG + Intergenic
1155474802 18:26226955-26226977 GCCGGGGGAGCGGCGCCGGCGGG - Exonic
1156275852 18:35581937-35581959 ACCGGGGACGCGGCCGCGGCGGG - Intronic
1157557686 18:48623344-48623366 GGCAGGGGCGCGGTAGGGGCAGG - Intronic
1157833677 18:50879389-50879411 GCCGGAGGCGCGGCAGCGCTGGG - Intronic
1158601891 18:58863357-58863379 ACTCGGGGCTCCGCAGCGGCCGG + Intronic
1159586590 18:70288824-70288846 GCGCGGGGCGGGGCGGGGGCCGG - Intergenic
1160157018 18:76441948-76441970 GGCCGGGGCGCGCGTGCGGCTGG + Exonic
1160204772 18:76823084-76823106 GCCCGGGGCGCGGTATCCGCAGG - Intronic
1160453383 18:78979904-78979926 GCCCCGGGTGCGGCTGTGGCGGG - Intergenic
1160523681 18:79523087-79523109 GCCCCGGGAGCGGCAAAGGCAGG - Intronic
1160679733 19:407204-407226 GCCTGGGGCCCGCCAGCGTCCGG - Exonic
1160706174 19:531367-531389 GCGCGGGGCGGGGCCGCGGGCGG - Intergenic
1160710443 19:548847-548869 GGGCGGGGGGCGGCAGCGGGGGG - Intronic
1160723869 19:609057-609079 GCTCGGGGCGCGGGAGAGGGGGG - Intronic
1160725014 19:614025-614047 GCCGGGGGCGTGGCCGGGGCGGG + Intronic
1160735970 19:662624-662646 GCGCGGCGCGGGGCAGGGGCTGG - Intronic
1160736086 19:663019-663041 GCCCGGGCCGGGGCGGCGGGCGG - Intronic
1160810067 19:1009407-1009429 GCCCGGGGAGCTGCAGGAGCTGG + Exonic
1160817391 19:1042453-1042475 GCCCGGGGTGGGGCAGTGCCAGG - Intronic
1160853518 19:1205970-1205992 GCCCGGGGCCCGGCACCTTCGGG + Intronic
1160868597 19:1266907-1266929 GGCCGAGGCGCGGGGGCGGCGGG + Intronic
1160871700 19:1280755-1280777 GAGCGGGGGGCGGCGGCGGCTGG - Intergenic
1160930463 19:1567638-1567660 GCCGGGGCGGCGGCGGCGGCGGG + Exonic
1160930713 19:1568354-1568376 GGCCGGGGCGGGGCCGCGGGAGG - Intergenic
1160930753 19:1568433-1568455 GCGCGGGGCGGGGCCGGGGCGGG + Intergenic
1161170150 19:2808455-2808477 GCCCGGGCAGGGGCAGGGGCAGG + Intronic
1161210339 19:3062370-3062392 GCCCGGGGCGCGCCGGGGCCGGG - Intronic
1161461515 19:4400394-4400416 GCCCGGACCGCGCCAGCGACAGG + Exonic
1161473474 19:4472658-4472680 CCCCGGGGCGCGGCTCCGGCAGG - Intronic
1161473551 19:4472876-4472898 CCCCGGGGCGCGGCTCCTGCAGG - Intronic
1161620110 19:5293188-5293210 ACGCGGGGAGCGGCTGCGGCGGG - Intronic
1161959544 19:7516188-7516210 GCCCGGGGGGAGCCGGCGGCCGG + Exonic
1162113278 19:8413068-8413090 GCCTGGGGCGGGGCTGGGGCGGG + Intronic
1162131105 19:8526672-8526694 GGCAGGGGCGGGGCCGCGGCCGG + Intronic
1162577108 19:11505553-11505575 ACCTGCGGCGCCGCAGCGGCTGG - Exonic
1162909835 19:13842813-13842835 GCCCGGCCCGGGGCGGCGGCCGG - Intergenic
1163313591 19:16528165-16528187 CCCCGGGGGCCGGCAGCTGCAGG + Exonic
1163320530 19:16572124-16572146 GCCAGGCGCGCAGCAGCGGCGGG + Exonic
1163551182 19:17967176-17967198 GCGCGGGGCCCGGGGGCGGCGGG - Intronic
1163723688 19:18910618-18910640 GCCCAGGGCGCAGCGGGGGCAGG - Intronic
1164594975 19:29526556-29526578 GCGGGGGGCGCGGTGGCGGCGGG - Exonic
1164615589 19:29665359-29665381 GCCCGGGAAGCGGGAGGGGCGGG - Exonic
1164639307 19:29812499-29812521 GCGCGGGGTGAGGCGGCGGCGGG - Intronic
1165199782 19:34134456-34134478 GCGAGGGGCGTGGCCGCGGCTGG + Intergenic
1165256054 19:34577803-34577825 GCTGGGGGCGGGGCAGGGGCGGG - Intergenic
1165349798 19:35269321-35269343 GCCGGGGGCGCCGCCGAGGCCGG - Intronic
1165453873 19:35899974-35899996 TCCCAGGGCGGGGCAGAGGCAGG + Intronic
1165939174 19:39406783-39406805 GCACGGGGCGGGGCCGGGGCCGG - Intergenic
1166079343 19:40434030-40434052 ACCCGGGAGGCGGCCGCGGCCGG - Intergenic
1166147722 19:40848793-40848815 GGCCAGGGGGCGGCAGGGGCAGG + Intronic
1166231427 19:41427457-41427479 GGCCGGGGCGGGGCTGAGGCAGG + Exonic
1166301891 19:41915761-41915783 GCCAGGGGGGCGCCAGGGGCAGG - Intronic
1166367162 19:42283811-42283833 GCCGGGGGCGGGGCCGCGGTAGG - Intronic
1166807281 19:45494815-45494837 GCCCTGGGGGCGGGGGCGGCGGG + Exonic
1166824843 19:45602241-45602263 GGCCGGGGCGGGGCCTCGGCTGG - Intergenic
1166853412 19:45770926-45770948 GCGCGGGGCGCGACGGCGGAGGG + Intronic
1166888250 19:45973941-45973963 GCCCGGGGGGCGGCGGGCGCGGG + Intergenic
1167308021 19:48719994-48720016 GCCGGGTGAGCAGCAGCGGCAGG + Intergenic
1167369655 19:49072835-49072857 GCGCGGGCGGCGGCGGCGGCGGG - Exonic
1167622659 19:50568051-50568073 GCGGGGGGCGGGGCTGCGGCCGG + Intergenic
1167643660 19:50694961-50694983 GCGCGGGGGGCGGCTGCGGCAGG + Intronic
1167738686 19:51311715-51311737 GCCCGGGGGGCGGCGGGGGCGGG - Intergenic
1167889344 19:52527514-52527536 GGCCGGGGCGGGGCCGGGGCGGG - Intergenic
1167889368 19:52527582-52527604 GGCCTGGGCGAGGTAGCGGCGGG - Intergenic
1168335933 19:55597804-55597826 ACCCTGGGGGCGGCAGCGGCGGG + Exonic
1168337013 19:55602639-55602661 GCCCGCCTCGCGGAAGCGGCGGG - Exonic
925068824 2:950776-950798 GCCCCGGGCGAGGGAGGGGCCGG - Intergenic
925069608 2:956208-956230 GGCAGGGGCGGGGCAGGGGCAGG - Intronic
925399038 2:3558560-3558582 GCCCTGGGCCCGGCAGAGGAAGG + Exonic
926422905 2:12716775-12716797 GCCCGAGGACTGGCAGCGGCGGG + Intergenic
927207488 2:20619327-20619349 ACACGGGGCTGGGCAGCGGCAGG + Intronic
927215847 2:20667426-20667448 GCCCGGGGAACCGCGGCGGCCGG - Exonic
927542739 2:23927202-23927224 GCCGGGGGCGGGGCAGCTGGAGG - Intergenic
927606569 2:24491510-24491532 GCCCGAGGAGCGGCGGAGGCCGG + Intergenic
927667588 2:25042839-25042861 TCCCGCGGGGCGGCAGGGGCAGG - Intronic
927714371 2:25342333-25342355 GCCGGGAGCGCGGCCGAGGCGGG - Intronic
927935085 2:27071791-27071813 GCCTCGGGCGCGGCTGCGGTGGG + Intergenic
929539657 2:42810167-42810189 GCCCAGGCCGGGGAAGCGGCAGG - Intergenic
930089473 2:47521211-47521233 GCCAGGGGCGCGCCAGGAGCCGG + Exonic
930727916 2:54699211-54699233 CTCCGGGACGGGGCAGCGGCCGG - Intergenic
932492022 2:72128337-72128359 GACCCGGGCGGGGCAGAGGCTGG + Intergenic
932599329 2:73112979-73113001 GCGCGGGGCGGGGCAGGGGGCGG - Exonic
934568781 2:95355067-95355089 GGCCGGGGAGCGGCAGAGTCAGG + Intronic
936396950 2:112138525-112138547 GGCCGGGGGGCGGCTGGGGCAGG - Exonic
937325717 2:120988721-120988743 GGCCGCGGCGTGGCAGCGACGGG + Exonic
937917651 2:127106803-127106825 GGCCGGGGCTCCGCGGCGGCTGG + Intronic
937951029 2:127388049-127388071 GCCGGGCGCGCGCCCGCGGCGGG - Intronic
938303405 2:130231538-130231560 CCCTGGGGAGCTGCAGCGGCTGG + Intergenic
938453268 2:131442694-131442716 CCCTGGGGAGCTGCAGCGGCTGG - Intergenic
938500516 2:131829529-131829551 GCCCAGGGCGCGGCCTCGGCGGG + Intergenic
940751237 2:157628911-157628933 GGCGGAGGCGCGGCAGGGGCGGG - Exonic
940830155 2:158457331-158457353 GCTGGGGACGCGGCAGCGGGAGG - Intronic
941666366 2:168247305-168247327 GCCGGGGCCGCGGGAGCTGCCGG + Exonic
941951495 2:171160834-171160856 GCCCGGGAGGCGGCGGCGGCGGG + Intronic
942450907 2:176107603-176107625 GCGCGGGGGGCGGCAGCAGCGGG + Exonic
942867357 2:180691773-180691795 GCACAGGGCGCGGGAGTGGCAGG + Intergenic
944582118 2:201140136-201140158 GCGGGGGCTGCGGCAGCGGCGGG + Intronic
944632665 2:201643056-201643078 GCCCGGGGCCCGGCGGGTGCCGG - Intronic
944831191 2:203535232-203535254 GCGCGCGGCGCGGGAGCTGCTGG - Exonic
946354876 2:219178327-219178349 GCTCGGGCGGCGGCTGCGGCGGG + Exonic
946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG + Exonic
946966469 2:225042401-225042423 GCCCGGGGCGCGCCTCCCGCCGG + Exonic
948116012 2:235494589-235494611 GCCCGGGGCGCCGCAGCCCCCGG - Exonic
948207028 2:236167860-236167882 GGCCGGGGCTGGGCTGCGGCGGG + Exonic
948492140 2:238320557-238320579 GACCGGGCGGCGGCGGCGGCGGG + Exonic
948592586 2:239060804-239060826 GCCCGGGCCGGGGCAGGTGCGGG - Intronic
948934059 2:241150729-241150751 GGCCCGGGGGCGGCAGCGGCCGG + Intronic
1171012021 20:21514025-21514047 GCTCGGCGCGCGGTGGCGGCTGG + Exonic
1172037032 20:32018223-32018245 GGCGGGGGCGGGGCAGGGGCAGG + Intronic
1172656461 20:36541423-36541445 GCGCGGGGCGGGGCCGCGGGCGG - Intergenic
1173060204 20:39653330-39653352 GCCCTGGGCGAGGCAGTGACTGG + Intergenic
1173586564 20:44187195-44187217 GAAGGGGGCGGGGCAGCGGCGGG - Exonic
1173792236 20:45834996-45835018 GCTCCTGGCGCGGCAGCTGCAGG + Exonic
1175424416 20:58854694-58854716 GCCCGGGTCTCAGCAGCCGCAGG - Exonic
1175424434 20:58854763-58854785 GCCCGGGTGGCAGAAGCGGCTGG - Exonic
1175428891 20:58889286-58889308 TCCCGGCGCGGGGCGGCGGCGGG + Intronic
1175429526 20:58891679-58891701 GGCCGGGCTGCGGCGGCGGCGGG - Intronic
1175448477 20:59042793-59042815 GCTGGGGGCGGGGCAGGGGCAGG - Exonic
1175731183 20:61354824-61354846 GCCAGGGGTGCAGGAGCGGCTGG + Intronic
1175826055 20:61937124-61937146 GCGCGGTGCTGGGCAGCGGCCGG - Exonic
1175847101 20:62064993-62065015 GGCGGGGGCGGGGCGGCGGCGGG + Exonic
1175904039 20:62371176-62371198 GCCAGGGGCCAGGCAGCGGTGGG - Intergenic
1175941382 20:62539022-62539044 GCCCGGAGCGGGGCAGGGGTGGG - Intergenic
1176077232 20:63254122-63254144 GACAGGTGCGGGGCAGCGGCTGG - Intronic
1176130492 20:63494731-63494753 GCCCAGAGCGAGGCACCGGCAGG - Intronic
1178196257 21:30348270-30348292 GCCCAGGGAGCGGCAGCTGCTGG + Intronic
1178198120 21:30371881-30371903 GCCCAGGGAGCGGCAGCTGCTGG + Exonic
1178200387 21:30396397-30396419 GCCCAGGGAGCGGCAGCTGCTGG - Exonic
1178203093 21:30430541-30430563 GCCCTGGGAGCGACAGCTGCTGG - Exonic
1178487340 21:33027457-33027479 GCCGGGTGCGCGGTGGCGGCGGG - Exonic
1179522248 21:41953328-41953350 GGCCGGGGGGCGGCAGATGCCGG - Intronic
1179794824 21:43776590-43776612 GACCGGGGCGGGGGCGCGGCCGG + Intergenic
1179908691 21:44436961-44436983 GCCTGGGGCGGGGCAGTGTCAGG - Intronic
1179926957 21:44540031-44540053 GGCCGGGGCGCAGCAGCTGAGGG + Exonic
1179929624 21:44558596-44558618 GGCCGGGGCGCAGCAGCTGGTGG + Exonic
1179931502 21:44573886-44573908 GGCCGGGGCGCAGCAGCTGGGGG - Exonic
1179939182 21:44627269-44627291 GGCCGGGGCGCAGCAGCTGGTGG - Exonic
1179942027 21:44646556-44646578 GGCCGGGGCGCAGCAGCTGGGGG - Exonic
1180002398 21:45001314-45001336 GCCCGGGGCCTGGTAGCAGCAGG + Intergenic
1180488297 22:15820469-15820491 GCCCGGGTGGGGGTAGCGGCAGG + Intergenic
1180871704 22:19150293-19150315 GGCCGGGGCGCCGCCGCCGCGGG + Intergenic
1180891457 22:19291815-19291837 GGCAGGGGCGGGGCAGGGGCGGG - Intergenic
1180891469 22:19291837-19291859 GGCAGGGGCGGGGCAGAGGCGGG - Intergenic
1181049420 22:20231541-20231563 GCCCTGAGCGTGGCAGGGGCAGG + Intergenic
1181130544 22:20729082-20729104 GCCTGGGGTGCTGCAGCAGCTGG - Intronic
1181283400 22:21735754-21735776 GCCCGCGGGGCGGCGGCGGGAGG - Exonic
1181510859 22:23388223-23388245 GGACAGGGCGCGGCTGCGGCGGG - Intergenic
1181831672 22:25564961-25564983 GCGCGGCGGGCGGCGGCGGCGGG + Exonic
1182087768 22:27573465-27573487 GGGCGGGGGGCGGCAGCGGGGGG - Intergenic
1182355346 22:29720251-29720273 GCCCGGGGCGCGGGGGCGCTAGG + Exonic
1182355463 22:29720598-29720620 GCCAGGGGCGCGGGGGCGGGGGG + Intronic
1183201424 22:36387774-36387796 GCCCGGGGCGGGACCGCGGTGGG + Intronic
1183427196 22:37746282-37746304 GCCGGAGGCGCGGCGGCGGGCGG + Intronic
1183513427 22:38249224-38249246 GCCCGGGAGGCGGAAGCCGCAGG - Intronic
1183586623 22:38756370-38756392 GCCCTGGGAGCGGCAGCGCGCGG + Intronic
1183667382 22:39253667-39253689 GCCCGGGCCGCCGCCCCGGCAGG + Intergenic
1183903355 22:41022229-41022251 GGCCCGGGCGCGGGAGCCGCGGG - Intergenic
1184155078 22:42662181-42662203 GCCCGGGGCGCGGGTCCAGCCGG + Intergenic
1184236873 22:43187362-43187384 GCAGGGGGCGCGGCAGGGGCGGG - Intergenic
1184439194 22:44498234-44498256 GCCGGGGCCGGGGCAGGGGCGGG + Exonic
1184439204 22:44498257-44498279 GCCGGGGTCGCGGCAGAGGGCGG + Exonic
1184523133 22:45007529-45007551 GCCGGGGGCGCGGCGCGGGCGGG + Intronic
1184557457 22:45240964-45240986 GGCCGGGGCGGGGAAGGGGCGGG - Intergenic
1184663744 22:45977033-45977055 GCCGGGGGCCCGGGCGCGGCTGG + Exonic
1185278622 22:49960654-49960676 GCCCGCGAGGCGGCGGCGGCCGG - Exonic
1185278856 22:49961379-49961401 GCACGGGCGGCGGCGGCGGCGGG + Intronic
1185285901 22:49999766-49999788 GCCCGGGGCGCGGAGGTGGGCGG + Intronic
1185313800 22:50170396-50170418 GGCCGGGCCGGGGCGGCGGCGGG - Intergenic
1185349490 22:50327113-50327135 GCCCGAGAAGCGCCAGCGGCCGG + Intergenic
1185371584 22:50463370-50463392 CTCCTGGGCGAGGCAGCGGCGGG + Exonic
1185376939 22:50487032-50487054 GCCTGGGGGTCGGCAGCCGCTGG - Intronic
949915801 3:8963480-8963502 GCCCGCGACGCGCCAGAGGCGGG + Exonic
949970000 3:9396754-9396776 GCGCGGGGCGCGGGGGTGGCGGG - Intergenic
949970332 3:9397949-9397971 GCCCAGGCCCCGGCAGCGCCTGG + Exonic
950018429 3:9769831-9769853 CCCCGCGGCGGGGCAGCCGCAGG - Exonic
950650211 3:14402539-14402561 GCCGGGGGCGGGGCCGGGGCGGG - Intergenic
954004016 3:47578313-47578335 GGCCGGGGCGGGGCCGGGGCGGG - Intronic
954004023 3:47578324-47578346 GCCGGGGGCGGGGCCGGGGCGGG - Intronic
954156152 3:48685935-48685957 GCCCGGGGCGGGGCTTCGGCGGG - Intronic
954711568 3:52507593-52507615 GCCCTGGGCAGGGCAGGGGCAGG - Exonic
954778900 3:53045427-53045449 GGCCGGGCGGCGGCAGTGGCGGG - Intronic
954796092 3:53161901-53161923 GCCGGGGGCGCGGCTCCGGGAGG - Intronic
955911595 3:63864008-63864030 TCCCCGGGGGCGGCCGCGGCCGG + Intergenic
958641495 3:96813381-96813403 GCCCGGAGCGCTGCAGAGCCCGG - Intergenic
961377331 3:126475694-126475716 GCCCGGGGCGCGGCCCGGGGAGG - Exonic
961501316 3:127338024-127338046 GCCAGGCGGGCGGCAGCTGCGGG + Intergenic
961599880 3:128052382-128052404 GCGCGGGGCGGGGCCGGGGCCGG - Exonic
961674320 3:128555533-128555555 CCTCGGGGCGCGTCCGCGGCAGG + Intergenic
962808880 3:138945722-138945744 GCCGGGGGCGCGGCGGTGGCTGG + Exonic
963035163 3:141019499-141019521 GCCCGGGCCGCGGGCGCAGCTGG - Intergenic
963091395 3:141486923-141486945 GGCGGGGGCGGGGCCGCGGCGGG + Intergenic
963673514 3:148280781-148280803 GCCCCGGGCGCGGGGCCGGCTGG + Intergenic
966861027 3:184230855-184230877 GCCCAGAGCGCGGCAGCAGGCGG - Exonic
967930450 3:194686862-194686884 GGCCGAGGCGCCGCCGCGGCAGG + Exonic
968477372 4:818343-818365 GCCCGTGGCGGGGCTGGGGCTGG - Intronic
968507874 4:980136-980158 GCCCTGGGCTCGGCAGCCCCTGG + Intronic
968583733 4:1406451-1406473 GCCCGAGCCGCCGGAGCGGCGGG - Intergenic
969520896 4:7677294-7677316 GGCCGGGGCGGGGCTGCTGCAGG - Intronic
969645820 4:8428267-8428289 GCCAGGGGCGCGGACGCGACGGG - Intronic
969716863 4:8871967-8871989 GCCCCGAGCGCGGCCGCTGCCGG + Intergenic
971279992 4:25234577-25234599 GCCCGCGGTGCGGCTGCGGCTGG - Intronic
971327429 4:25655736-25655758 GCCCCGGCGGCGGCTGCGGCAGG + Intronic
972321691 4:37977815-37977837 GCGCGGGGAGCGACAGGGGCCGG - Intronic
972406500 4:38751533-38751555 GCCCGGGGCGGTTCAGCTGCCGG + Intergenic
974047248 4:56908261-56908283 GCCCGGGCGGCGGCAGTGGCGGG + Intronic
975883550 4:78939230-78939252 AGCCGGGGAGCGGCGGCGGCCGG - Exonic
976178000 4:82373755-82373777 AGCGGGCGCGCGGCAGCGGCGGG - Exonic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
976704800 4:88008396-88008418 GCCCGGGGAGCTGCCGCAGCGGG - Intronic
977257564 4:94757976-94757998 GCGCGGGGCGCGGAGTCGGCGGG + Intronic
977536568 4:98261391-98261413 GCAGGCGGCGCGGCCGCGGCGGG - Intronic
977941978 4:102869000-102869022 GCGCCGGGAGCGGAAGCGGCCGG - Exonic
982042389 4:151409099-151409121 GGCCGGGGCGGGGCAGGGGCGGG - Intergenic
983792238 4:171813049-171813071 AGCCGGGGCGCGGCGGCTGCGGG - Intronic
983940197 4:173529333-173529355 GCCCGGGCCGAGGGCGCGGCGGG - Exonic
985550140 5:528661-528683 GCGCGGGGCGGGGCGGCGGCCGG - Intergenic
985660711 5:1155518-1155540 GCGCGGCGGGCGGCAGGGGCGGG + Intergenic
986330615 5:6713912-6713934 CCTCGGGGCGCGGCGGGGGCGGG + Intergenic
986608619 5:9546167-9546189 GGCGGGGGCGGGGCAGGGGCGGG - Intergenic
987302189 5:16606787-16606809 GCCTGGGGCGAGGCACCAGCTGG - Intronic
992473240 5:77077698-77077720 GCCCGGGGCGCCCCGGCGCCAGG + Exonic
994072885 5:95621074-95621096 GACCAGGGCGCTGCAGCCGCGGG - Exonic
994197270 5:96935219-96935241 GCCCGGGTCGCGGGCGCCGCAGG - Intronic
996379022 5:122845461-122845483 GCCCAGGGCGCGGGAGCGGCCGG + Exonic
998101535 5:139439154-139439176 GCCCTGGGCGGGGCACGGGCGGG + Intronic
998371810 5:141666601-141666623 GCCCGGGGCCCAGCAGCTGGTGG + Exonic
1002103323 5:176868110-176868132 GCCCTGGGGGCGGGAGGGGCAGG - Exonic
1002140404 5:177134087-177134109 GCCGGCGGCGCTGCAGCCGCCGG + Intronic
1002277451 5:178113410-178113432 GCCGGGGGCGCGGTCGGGGCCGG + Intergenic
1002450225 5:179314537-179314559 GCCCGGGGGGCTGCAGAGGCAGG - Intronic
1002452422 5:179326464-179326486 GCCGGGGGCGGGGCACAGGCCGG - Intronic
1002532821 5:179858847-179858869 GCGTGGGGCGGGGCCGCGGCGGG - Exonic
1002632304 5:180590308-180590330 GGCGGGGGCGCGGCAGCGGCCGG + Intronic
1002792973 6:449129-449151 GCCCAGGGCCCGCCAGCGCCAGG - Intergenic
1002929647 6:1624426-1624448 GCCCGGGGCCCCGCAGCGGGCGG + Intronic
1003116407 6:3286639-3286661 GCCCGGGCCGGGGCAGGGGCAGG + Intronic
1003206550 6:4018379-4018401 ATCCGGGGCGCGGCGGCGACAGG + Intergenic
1003301712 6:4889930-4889952 GCCTGGGGCCTGGCAGCAGCAGG + Intronic
1003506617 6:6745690-6745712 GCACAGGGCGCGGCACTGGCAGG - Intergenic
1004044673 6:12012375-12012397 GACCGGGGAGCGGCGGCCGCCGG + Exonic
1004627929 6:17393942-17393964 GCGCGGGGCGCGGGCGCGGGCGG + Intronic
1005825201 6:29628080-29628102 GGGCGGCGCGCGGCAGCGGGGGG + Intronic
1005960733 6:30691033-30691055 GCCGGGGGCGGGGCCGCGGGCGG - Exonic
1006129889 6:31862782-31862804 GCCAGGGTCGCGGCAGCTGCGGG - Exonic
1006135835 6:31896354-31896376 GCCCAGGGAGCTGCAGCAGCAGG - Exonic
1006284261 6:33080986-33081008 GCCCAGGGCGCAGGAGCAGCCGG + Intronic
1006396157 6:33788863-33788885 GCCCGCGGAGAGGCCGCGGCGGG + Exonic
1006814325 6:36840053-36840075 GGCCGGGGCGGGGCCGCGGGCGG + Intergenic
1009975677 6:70668197-70668219 GCCCCGAGCGCCGCAGCGGCGGG - Intronic
1011517340 6:88167241-88167263 GACTCGGGGGCGGCAGCGGCGGG + Intergenic
1012465855 6:99515519-99515541 GCCCGGGGCCCGGGAGCGCGGGG + Intronic
1013272686 6:108558635-108558657 GCCCGGAGCCCGGAGGCGGCTGG + Intergenic
1013836572 6:114342270-114342292 GTCCGGACCGCAGCAGCGGCCGG - Exonic
1014724951 6:124962561-124962583 GCACGGTGAGCGGCGGCGGCGGG + Exonic
1015149107 6:130019310-130019332 GCGGGGGGCGCGGGGGCGGCCGG + Intronic
1015965645 6:138693290-138693312 GCGCTGGGCGCGGCAGCCGCGGG - Intergenic
1016010736 6:139135475-139135497 GCCGGGGCCCTGGCAGCGGCGGG + Exonic
1017497680 6:154995689-154995711 CCCCGGAGGGCGGCAGCGTCCGG + Intronic
1017842298 6:158232057-158232079 GGCCGGGGGGCGCCAACGGCCGG + Intergenic
1018150286 6:160931185-160931207 GCCCGGGGCGGGGGCGCGGGTGG + Intergenic
1018613054 6:165662157-165662179 GCCGGGGCGGCGGCGGCGGCCGG + Intronic
1019196575 6:170286750-170286772 GCCGGGGGCGCGGGGGAGGCCGG - Intronic
1019330628 7:458887-458909 GCCCAGGGCCCTGCAGCAGCAGG + Intergenic
1019353762 7:568475-568497 GCCCGGGGCGGGCCAGCTCCAGG - Intronic
1019415490 7:924895-924917 GCCCGGGGCACGGCCAGGGCAGG + Intronic
1019473386 7:1232943-1232965 GGCCGGGGCGGGCCAGCGGCGGG - Exonic
1019536168 7:1530922-1530944 GCCCGGGCCGCGGCGGGGACGGG + Intronic
1020105722 7:5421411-5421433 GCCCGGGGCGCACAGGCGGCCGG + Exonic
1021452774 7:20798054-20798076 GCCCGGGCTGCGGCGGCCGCGGG + Intergenic
1022020904 7:26398627-26398649 GCCCCGGGAGCCGCGGCGGCCGG - Intergenic
1022091414 7:27110279-27110301 GGCGGGGGCGCGGCAGGGGTAGG + Exonic
1022230535 7:28409146-28409168 CGCCCGGGAGCGGCAGCGGCGGG - Intronic
1022400184 7:30028820-30028842 GCCGGGGGCGCGCCGGGGGCCGG + Intronic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1023972287 7:45000230-45000252 GCCGGGAGCGCGGGGGCGGCGGG + Intronic
1024472117 7:49775258-49775280 GCCCGGGTGGGGGCCGCGGCGGG + Intronic
1024579848 7:50793028-50793050 GCCCGGGGCGCCGGAGCCCCCGG + Intronic
1024611458 7:51068014-51068036 GGCTGGGGCTAGGCAGCGGCAGG - Intronic
1025940858 7:66075630-66075652 CCCCGGGGCGGGGAAGCGGGCGG - Intergenic
1026458890 7:70596168-70596190 GGCCGGGGCGGGGCTGGGGCGGG + Intronic
1026732665 7:72925189-72925211 GCCGGGGCCGGGGCTGCGGCGGG + Intronic
1026765056 7:73155089-73155111 GCGCGGGGGGCGGCGGCGGCCGG - Intergenic
1026858377 7:73769524-73769546 GGCCGCGGCGCTGCAGCTGCTGG - Exonic
1026979549 7:74518339-74518361 GCCCGGGGCTGGGCTGGGGCTGG + Intronic
1027041529 7:74964844-74964866 GCGCGGGGGGCGGCGGCGGCCGG - Exonic
1027082113 7:75237525-75237547 GCGCGGGGGGCGGCGGCGGCCGG + Intergenic
1027111400 7:75442630-75442652 GCCGGGGCCGGGGCTGCGGCGGG - Intronic
1029390694 7:100272071-100272093 GCGCGGGGGGCGGCGGCGGCCGG + Exonic
1029444331 7:100604263-100604285 GCTGGGGGCGGGGCTGCGGCCGG - Intronic
1029715071 7:102321316-102321338 GCCGGGGACGCGGGCGCGGCAGG - Exonic
1031406753 7:121396028-121396050 GCCCGGGGCCCGCCCCCGGCCGG + Intronic
1031966592 7:128031785-128031807 GCCGGGGGCCGGGCAGCGGCGGG - Intronic
1031997243 7:128240926-128240948 GCGCGGGGCGCGGTCGGGGCGGG - Intergenic
1032020725 7:128406000-128406022 GCGGGGGCTGCGGCAGCGGCAGG + Intronic
1032525463 7:132576202-132576224 GCCCGCGGAGGTGCAGCGGCCGG - Intronic
1034445988 7:151114696-151114718 GCCCGGGCCGGGGCCGCGGCCGG - Intronic
1034447863 7:151122613-151122635 GCCTGGGGAGCGGCGGCAGCGGG - Intronic
1034449400 7:151129333-151129355 GGCCGGGGCGGGGCAGTGGGGGG - Intronic
1034455502 7:151167818-151167840 GAGCCGGGCGCGGCGGCGGCGGG - Intronic
1034911591 7:155002748-155002770 GCCCGGCGCGCGCCCGCGGCAGG + Intronic
1034977713 7:155457894-155457916 GGCCGGGCGGCGGCGGCGGCCGG + Intergenic
1035266004 7:157690617-157690639 CCTCGGGGCGCAGCAGCTGCGGG + Intronic
1035266067 7:157690889-157690911 GGCCGGGGCGCGGCGCGGGCGGG + Intronic
1035404257 7:158587834-158587856 GCCGGGGGCGGGGCCGGGGCGGG - Intergenic
1035573348 8:688294-688316 GCCCGGGGCGGGGCGGCGGAAGG - Intronic
1035608761 8:947203-947225 GCCCGGGGAGCTGCATCTGCAGG + Intergenic
1036210345 8:6835565-6835587 GCCCGGGGCCCGACTGCGGGTGG + Exonic
1036434806 8:8723437-8723459 CCGAGGGGCGCGGCAGGGGCCGG - Intergenic
1038540264 8:28385627-28385649 GCGCGGGGCGCGGGAGGGCCGGG + Intronic
1040423410 8:47260963-47260985 GCCCCGAGCGCGGCTGCCGCGGG - Exonic
1042040219 8:64581386-64581408 GCCTGGGCGGCGGCGGCGGCGGG + Exonic
1042367334 8:67952315-67952337 GCCGGGGGCCGGGCAGCAGCGGG + Exonic
1042532779 8:69832628-69832650 GCCCGGGGCGGGAGAGCAGCTGG - Exonic
1042784925 8:72536797-72536819 CCCGGGTGCGCGGCAGCCGCGGG + Intergenic
1043542814 8:81281429-81281451 GGCCGGGGCGCCGCAGTGGGCGG + Intronic
1043847300 8:85177548-85177570 GCGCCGGGGGCGGCAGCAGCAGG + Exonic
1044857782 8:96494061-96494083 TCCCGGGGCGCAGCTGCGGGCGG + Exonic
1045305040 8:100951368-100951390 GCGCTGGGCGCTGCGGCGGCGGG - Intronic
1045336109 8:101205597-101205619 GGCGGGCGCGCGGCGGCGGCGGG - Intronic
1045489072 8:102655696-102655718 GCGCTGAGCGCGGCGGCGGCGGG - Exonic
1046547432 8:115669110-115669132 TCCCGGCGGGCGGCGGCGGCGGG - Intronic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1049003924 8:139843006-139843028 GCCTGGGGCTGGGCAGTGGCTGG - Intronic
1049109666 8:140635308-140635330 GCTCGAGGAGCGGCGGCGGCGGG - Intronic
1049145887 8:141000957-141000979 GCCGGGGGCGCGGGAGGGGCCGG + Intronic
1049194516 8:141308108-141308130 GCCGGGGCCGCGGGGGCGGCGGG + Intronic
1049194627 8:141308487-141308509 GGCAGGGGCGCGGCGGGGGCGGG - Intergenic
1049288583 8:141789949-141789971 GCCAGCGGGGCGGCAGCGGCAGG - Intergenic
1049532253 8:143160365-143160387 GCGCGGGGGGCGGGGGCGGCTGG + Intronic
1049614087 8:143568789-143568811 GCGCGGAGCGAGGAAGCGGCGGG + Intronic
1049625364 8:143617440-143617462 GCCCAGGGCGCGGCTGAGTCCGG + Intronic
1049659963 8:143815502-143815524 GACGGGGACGCGGCCGCGGCCGG + Intergenic
1049668929 8:143860931-143860953 GCCCGGGCCGAGGCCGAGGCCGG - Exonic
1049669344 8:143862533-143862555 GCCCGGGCCGAGGCCGAGGCCGG - Exonic
1049669756 8:143864126-143864148 GCCCGGGCCGAGGCCGAGGCCGG - Exonic
1049670171 8:143865734-143865756 GCCCGGGCCGAGGCCGAGGCCGG - Exonic
1049724220 8:144138052-144138074 TCCCGGGCCGGGGCAGAGGCCGG - Exonic
1049762447 8:144337382-144337404 GCCTGGGGCGCGGGATCTGCGGG + Intergenic
1049762706 8:144338249-144338271 GCCCCGGCCCCGGCAGCGGCGGG + Intergenic
1053072883 9:35111478-35111500 GGGAGGGGCGCGGCAGCGGCTGG - Exonic
1053163531 9:35829424-35829446 GCCCGGGGCGGGGGCGGGGCCGG - Intronic
1055447152 9:76394566-76394588 GAGCCGGGCGAGGCAGCGGCGGG - Intergenic
1055514069 9:77019645-77019667 GCCGGGGGCGATGCCGCGGCCGG + Exonic
1056163548 9:83921266-83921288 GCTGGGGGCGCGGGAGCGGCGGG + Intronic
1056811800 9:89770954-89770976 GCCCAGGGCTTTGCAGCGGCTGG + Intergenic
1057425442 9:94945583-94945605 GGCATGGGGGCGGCAGCGGCAGG - Intronic
1057494959 9:95553501-95553523 GGCCGCGGCGGGGCGGCGGCTGG - Intergenic
1059191765 9:112333648-112333670 GGCGGGGGCGCGGCGGTGGCGGG - Intronic
1059197037 9:112380057-112380079 GGCAGGGGCGGGGCAGGGGCGGG + Exonic
1059230678 9:112718307-112718329 GCCCGGGGCGGGGGAGGGGCGGG + Intergenic
1059950887 9:119461449-119461471 GCCCGAGGGGAGGCAGTGGCAGG - Intergenic
1060540791 9:124428873-124428895 GCCCTGGGCACGTCTGCGGCAGG + Intergenic
1060700534 9:125746733-125746755 GCCCGGTCCGCGGCGGCTGCTGG + Intergenic
1060811080 9:126611849-126611871 GGCGGGGGCGCGGCTGCTGCAGG - Intergenic
1060856089 9:126915412-126915434 GCCCGGGGACCTGCAGCGGTGGG + Intronic
1060879492 9:127108061-127108083 ACCCGGGGCGGGGCAGCGGGGGG + Exonic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1061208611 9:129178126-129178148 GCCCGGCGCGCCCCGGCGGCCGG - Exonic
1061275792 9:129568902-129568924 GCCTGGGGGGCGGCGGGGGCGGG - Intergenic
1061382210 9:130265486-130265508 GCCCCCGGCGCGCCATCGGCGGG + Intergenic
1061725986 9:132582317-132582339 GCCCGGGCCGCGCTAGCAGCGGG - Exonic
1061961913 9:133992826-133992848 GCAGGGGGCGCGGCCACGGCCGG + Intergenic
1061975960 9:134068155-134068177 GGGCGGGGCGCGGCGCCGGCGGG - Intronic
1062037855 9:134390670-134390692 GCCCTGGGAGTGGCAGAGGCAGG + Intronic
1062220210 9:135410997-135411019 GCCCGGGCTGCAGCTGCGGCAGG + Intergenic
1062289910 9:135789822-135789844 GCCTGGGGTGGGGCAGGGGCTGG - Intronic
1062341420 9:136095320-136095342 GGCGGGGGCGGGGCGGCGGCGGG + Intergenic
1062385780 9:136310986-136311008 GCCTGGGACCCGGCAGCGGCCGG + Intergenic
1062500120 9:136848657-136848679 GCGCGGGGCGCGGCGGCGGGTGG - Exonic
1062516691 9:136940515-136940537 GCCCGGGGCTTGGGAGCGGCCGG - Exonic
1062584188 9:137241595-137241617 GCGCGGGGCGGGGGAGGGGCGGG + Intronic
1062623727 9:137433869-137433891 GCCAAGGGCGAGGCAGGGGCAGG + Intronic
1203771917 EBV:53883-53905 GCCCTGGCCCGGGCAGCGGCCGG - Intergenic
1185432968 X:19964-19986 GCCCGGGGCTGGGCCGCTGCGGG - Intergenic
1185504028 X:619166-619188 CCCCGGGGCGAGGCAGGGGAGGG - Intergenic
1185747525 X:2584399-2584421 GCCCGGTGAGCGCCAGCAGCTGG - Intergenic
1187341650 X:18426036-18426058 GCTCGTGCCGCGGGAGCGGCGGG - Intronic
1189001946 X:36957516-36957538 GCCAGGGCCGCGGTAGGGGCGGG + Intergenic
1189231595 X:39456176-39456198 GCTGGGGGCGGGGCAGCGGGTGG + Intergenic
1189988755 X:46575432-46575454 GCCCGGGGCAAGGCAGGGACCGG + Intronic
1190024664 X:46912539-46912561 GCGCGGGGGGCGGCCCCGGCGGG + Exonic
1190265689 X:48826365-48826387 GGCAGGGGCGGGGCAGTGGCAGG + Intergenic
1190285224 X:48957203-48957225 GCGCTGGGCGCAGCGGCGGCGGG - Exonic
1190881687 X:54496129-54496151 GCCTGGGTCTCGGCGGCGGCGGG + Exonic
1192746527 X:73944210-73944232 GGCTGGGGCACGGCAACGGCTGG + Intergenic
1195954882 X:110318157-110318179 GCCGGGGGCGCGCCAGAGGCTGG + Exonic
1197782444 X:130171686-130171708 GGCCGAGGCGCGGCGGCGGCTGG + Exonic
1198438114 X:136636569-136636591 GTCTGGGGCGGGGCAGCGGTTGG + Intergenic
1200118839 X:153781051-153781073 GCCCGGGGCACCGGAGCTGCGGG + Exonic
1200239605 X:154486735-154486757 GGCCGGGGCGCGGACGGGGCAGG - Intergenic