ID: 1023002599

View in Genome Browser
Species Human (GRCh38)
Location 7:35826539-35826561
Sequence GGGTGTGTTAAGGTAATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023002595_1023002599 21 Left 1023002595 7:35826495-35826517 CCTTGGATTTTTGTAGCTTGATG 0: 1
1: 0
2: 0
3: 35
4: 348
Right 1023002599 7:35826539-35826561 GGGTGTGTTAAGGTAATTTGAGG 0: 1
1: 0
2: 0
3: 14
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023002599 Original CRISPR GGGTGTGTTAAGGTAATTTG AGG Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
904402287 1:30264619-30264641 GGGTGAGTTAAGGTGCTGTGAGG + Intergenic
905141484 1:35848793-35848815 GGATGTGTTTAGGTATTTTATGG - Intronic
905673576 1:39809043-39809065 GGGCCTGTAAAGGTAATTTGGGG - Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906464591 1:46065461-46065483 AGGTGTGTTCAGCTAATGTGGGG - Intronic
907120737 1:52005998-52006020 GGGTGTGTTGCGGTAAACTGAGG - Intergenic
909896083 1:81070736-81070758 GAGTGTTTTAAGGATATTTGAGG - Intergenic
913304288 1:117408855-117408877 GGTTGAGTTTTGGTAATTTGTGG + Intronic
916899162 1:169201985-169202007 GGATGTGGTAAGATAATCTGGGG + Intronic
922778815 1:228233713-228233735 GGGTGAGTATTGGTAATTTGTGG + Intronic
1065138209 10:22693683-22693705 GTGTGTGTTAAGGTCATCTGTGG - Intronic
1069336565 10:67358566-67358588 GGGTGAGTTAAGGAATTCTGGGG + Intronic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1078554907 11:12316062-12316084 GGCTGTATCAAAGTAATTTGTGG - Intronic
1078893065 11:15574813-15574835 AGGTGGGTTAAGGCCATTTGAGG + Intergenic
1084822287 11:71700602-71700624 GGCTGTGTTAGGGCATTTTGGGG - Intergenic
1085385078 11:76153020-76153042 GGGTGAGGTCAGGAAATTTGGGG - Intergenic
1085845807 11:80063263-80063285 TGCTGTGTTAAGATAGTTTGGGG - Intergenic
1086329860 11:85743207-85743229 GGGTGTGTTAAGTGTATTTTGGG - Intronic
1087768227 11:102179318-102179340 GAGTGTGTAAAAGTTATTTGGGG + Intronic
1089763665 11:120747518-120747540 AGGAGTGTTAAGGTAGTTTGAGG + Intronic
1091905254 12:4181292-4181314 GGGTGAGTTTTGGTAGTTTGTGG - Intergenic
1092131317 12:6115018-6115040 GGGAGTGGCAAGGGAATTTGGGG + Intronic
1096632568 12:52938104-52938126 GGGTGTGTAATGGTATCTTGTGG - Intronic
1097746131 12:63305210-63305232 GTGTGTGTTAAGGAAATTGTCGG + Intergenic
1099743961 12:86678281-86678303 GGGTGGAATAAGGTAAGTTGAGG - Intronic
1099960781 12:89395057-89395079 GGGTGTGAGCAGGTGATTTGGGG + Intergenic
1101238208 12:102811421-102811443 GTGTGTTTTAAAATAATTTGAGG + Intergenic
1102192342 12:110998182-110998204 GGGTGTTTAAAGATAGTTTGTGG - Intergenic
1102722053 12:115024992-115025014 GTGTGTGTGTAGGGAATTTGGGG + Intergenic
1104512705 12:129395082-129395104 GGAAGTTTTGAGGTAATTTGGGG - Intronic
1104640635 12:130464797-130464819 GAGTGTGTTAGGGGAATGTGTGG - Intronic
1105035358 12:132916275-132916297 GGGTGAGTTTTGGTAGTTTGTGG + Intronic
1105044367 12:132989634-132989656 GGTTGTATTAAGTTAATGTGTGG + Intronic
1105732998 13:23238125-23238147 CAGTGAGTTAAGGCAATTTGAGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1105817286 13:24048130-24048152 GGGTGTGTTGAGGGTATTTCTGG - Intronic
1105906430 13:24815015-24815037 AGGTGTGTGTATGTAATTTGGGG + Intronic
1106371850 13:29142258-29142280 GGGTTTGTTAAAACAATTTGAGG + Intronic
1109268207 13:60224929-60224951 GAGTGTGTTAAGATATGTTGAGG - Intergenic
1109847353 13:68012815-68012837 GTGTGTGTTAATGAAATTTATGG + Intergenic
1111693444 13:91593145-91593167 GGGTGAGTTAAGGAAATGTGGGG - Intronic
1120912841 14:89683270-89683292 AGGGGTGTTAAGGTAGTCTGAGG + Intergenic
1125067348 15:35504238-35504260 AGGAGTGAGAAGGTAATTTGGGG - Intronic
1127778629 15:62291204-62291226 GGGTGTGTTCAGATAAATTTAGG - Intergenic
1129934416 15:79437649-79437671 GGGTGTGTGTAGGTAGTGTGTGG + Intronic
1129934439 15:79437740-79437762 GGGTGTGTGTAGGTAGTGTGTGG + Intronic
1131328751 15:91475473-91475495 GGGTGAGTTTTGGTAGTTTGTGG + Intergenic
1132257922 15:100393640-100393662 AGTTGTGTTGAGGTTATTTGGGG + Intergenic
1133467271 16:6039629-6039651 GAGTGTGTTCAGTTATTTTGAGG + Intronic
1134743403 16:16568911-16568933 GGGTGTTTCTTGGTAATTTGTGG - Intergenic
1134924155 16:18143550-18143572 GGGTGTTTCTTGGTAATTTGTGG + Intergenic
1137059005 16:35768138-35768160 GGGTGTGTTTAGTTTTTTTGTGG + Intergenic
1137907953 16:52344380-52344402 GAGTGAGTTAAGGTAGTATGGGG - Intergenic
1140300585 16:73753476-73753498 GAGTGGGTTAAAGTAAATTGAGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142315701 16:89343672-89343694 TGGTCTGTGAAGGTAATTGGTGG - Intronic
1142540674 17:656496-656518 GGGAGTGAGAAGGCAATTTGGGG + Intronic
1149115775 17:53094438-53094460 GGTTGTGTTAACGTAACTTTAGG + Intergenic
1149174708 17:53855436-53855458 GTGTGTATTATGTTAATTTGGGG - Intergenic
1149558282 17:57589745-57589767 GGGAGTGTGAAAGTAACTTGGGG + Intronic
1150658652 17:67056895-67056917 GGGTATGTTGAGGTCTTTTGTGG + Intergenic
1151534769 17:74732476-74732498 GTGTGTGGTGAGGTGATTTGAGG + Intronic
1151998225 17:77626055-77626077 GGGTGAGTTGTGGTAGTTTGTGG + Intergenic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1156239255 18:35236336-35236358 GGGGGCTTTAAGGTAATTTGGGG + Intergenic
1156329179 18:36103007-36103029 GGGTGAGTTTTGGTACTTTGTGG + Intergenic
1156381927 18:36570320-36570342 GGGTGGGTTTTGGTAGTTTGTGG - Intronic
1157707339 18:49818603-49818625 GGGTTTGGTTAGGTGATTTGGGG + Intronic
1157941366 18:51932568-51932590 GGGTTTGTTAATGTATTTTTCGG - Intergenic
1158236029 18:55315038-55315060 GGGCATGTTGAGGTAATTGGTGG - Intronic
1160216342 18:76935745-76935767 GGGTGTGTGGAGGGAATTTTAGG + Intronic
1162839969 19:13349290-13349312 GGGTGTCTTGAGTTAATTTGGGG - Intronic
1162957510 19:14107457-14107479 GGGTGGGTTCAGGTGATTTCTGG + Intronic
1163695225 19:18760465-18760487 GGGTGTGTGATGGTGCTTTGGGG + Intronic
933156403 2:78980489-78980511 GGATGTGTTAAAACAATTTGAGG - Intergenic
933385584 2:81606737-81606759 GGGGGTGTGCAGGAAATTTGGGG + Intergenic
935845277 2:107159636-107159658 GGGTTTGATAATGTAATTTTAGG + Intergenic
938015807 2:127866276-127866298 GGCTGTGCTAAGGTAATGTATGG - Intronic
941291739 2:163684152-163684174 GTGTGTGTAAAGATAATTTTTGG - Intronic
943343522 2:186709760-186709782 GGGTGTGGAAATGAAATTTGAGG - Intronic
944688625 2:202139858-202139880 GGGTGTGTTTAGGGTATGTGAGG - Intronic
946971937 2:225103363-225103385 TGCTGTGTTAAGATATTTTGAGG + Intergenic
947379089 2:229527561-229527583 TGGTGTCTCAAGGAAATTTGGGG + Intronic
1170162703 20:13330727-13330749 GGGTGAGTTTAGATAGTTTGTGG + Intergenic
1181842221 22:25673622-25673644 GGATGTTTTAAGGTTGTTTGGGG + Intronic
1185101679 22:48843943-48843965 GGGTGTGTTGAGGCACTGTGGGG - Intronic
951070652 3:18325376-18325398 GGGTGAGTTTTGGTAGTTTGTGG + Intronic
951941365 3:28082389-28082411 TTGTGTGTTAGGGTAATTTAGGG - Intergenic
953368204 3:42365161-42365183 GGGTATTTTATGGTAATTTGGGG + Intergenic
954012219 3:47651398-47651420 TGAGATGTTAAGGTAATTTGTGG - Intronic
957597533 3:82287410-82287432 GGGTGAGTGAAGGAAACTTGGGG + Intergenic
960061230 3:113323719-113323741 GGGTGAGTCATGGTAGTTTGTGG - Intronic
962148218 3:132864337-132864359 GGGTGAGTTTTGGTAGTTTGTGG + Intergenic
967128340 3:186447097-186447119 GTCTGTGTTAAGGTAAATTTGGG - Intergenic
967272318 3:187741752-187741774 GGGTGTGTTGAGGAGGTTTGTGG - Intronic
967703550 3:192622410-192622432 GGGTGTCTTAGGGTACTGTGAGG - Intronic
970159881 4:13177742-13177764 GGGTGTGTTGAGCACATTTGTGG - Intergenic
971581392 4:28345551-28345573 GGGTGTGGGAAGGTAATATGAGG + Intergenic
972912821 4:43839145-43839167 GGTGATGTTAAGGTAATTTGGGG + Intergenic
975344899 4:73282322-73282344 GGGTGTGTGAAGGAACTCTGGGG - Intergenic
975575100 4:75854596-75854618 GGGTCTGTTAATATAATTTGAGG + Intergenic
976627509 4:87202614-87202636 GGGTGAGTTTTGGTAGTTTGTGG - Intronic
976835109 4:89363015-89363037 GGGTGTGTTTTTGAAATTTGTGG + Intergenic
982780946 4:159490877-159490899 TGGTGTGTTAAGGGTGTTTGAGG + Intergenic
988266433 5:28957253-28957275 AGGTGTGTTAAGGTTTATTGAGG - Intergenic
988571502 5:32371887-32371909 GGGTATGTGAAGCTAATTTGGGG - Intronic
992400409 5:76405685-76405707 TGGTGTGTTAGTGTAATTTCTGG + Intronic
994279087 5:97878326-97878348 GGTTGTTTAAAGATAATTTGAGG + Intergenic
998619884 5:143782197-143782219 GGATGTGTTAGGCTCATTTGAGG + Intergenic
999886287 5:155926703-155926725 GGGAGTGTTAAAATAAATTGAGG + Intronic
1000192512 5:158925038-158925060 GGGTGAGTTTAGTTTATTTGAGG - Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1005230245 6:23692662-23692684 GGTTGTGTTAAAGTTAATTGAGG - Intergenic
1005270285 6:24156374-24156396 GGGTCTGAAAAGGGAATTTGGGG - Intergenic
1007524273 6:42477797-42477819 GGGTGTGTTTAGGACATTTTGGG + Intergenic
1009400613 6:63250875-63250897 TGGTGTGTTATATTAATTTGTGG + Intergenic
1010049871 6:71490186-71490208 AGGTGTGTGAAGGCAGTTTGGGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1011762569 6:90584479-90584501 GTGTGTGTTTAGGAAATTTCTGG - Intronic
1012044313 6:94250040-94250062 GTGTTTGTTAAGGTAATTCTAGG - Intergenic
1013420856 6:109965504-109965526 GGGTGTGTTATGCTCATGTGTGG - Intergenic
1013440844 6:110166357-110166379 TGGTGTGAAAATGTAATTTGGGG - Intronic
1013511669 6:110850362-110850384 GGGAGGGTCAAGGGAATTTGGGG - Intronic
1014036532 6:116772418-116772440 AGTTGTCTTAAGGTAATCTGAGG - Intergenic
1015047723 6:128796982-128797004 GGGTGAGTTTAGGTAGTTTGTGG - Intergenic
1017699980 6:157059672-157059694 GGGCGTGCTAAGGAAATTTAGGG - Intronic
1020906649 7:14071670-14071692 GGGTCAGTTTAGGTAGTTTGTGG + Intergenic
1023002599 7:35826539-35826561 GGGTGTGTTAAGGTAATTTGAGG + Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1032279234 7:130487423-130487445 GGGTGTGTGAAGATAGTTTAGGG + Intronic
1033533511 7:142289926-142289948 GGTGGCTTTAAGGTAATTTGGGG + Intergenic
1035268131 7:157703502-157703524 GGTTGTGTTAAGCTAAGTTTCGG + Intronic
1037713857 8:21379738-21379760 GGGTGTGTGCAGCTATTTTGGGG + Intergenic
1038876577 8:31557895-31557917 GGGTGAGTGAAGGAACTTTGGGG + Intergenic
1040430420 8:47335988-47336010 TGGTGTGTAACAGTAATTTGGGG + Intronic
1041816845 8:61982888-61982910 GGATCTGTGAAGGTACTTTGAGG - Intergenic
1044272435 8:90262744-90262766 GGTAATCTTAAGGTAATTTGGGG - Intergenic
1046800984 8:118426304-118426326 GGGTGACTCAAGGTAATTAGAGG - Intronic
1048030401 8:130626211-130626233 GGGTGGGGAAAGGCAATTTGAGG - Intergenic
1052046456 9:23799694-23799716 GGGTGTGGTAAGGCAATTAGGGG - Intronic
1057091707 9:92263992-92264014 GGGTGTGTTAAAGGAATTGTTGG - Intronic
1057634303 9:96748905-96748927 GGGTGAATTTTGGTAATTTGTGG + Intergenic
1060694577 9:125696859-125696881 ATGTGTGTTAAGGTAAACTGAGG - Intronic
1186694413 X:12014713-12014735 GTGTGTGTTTAGGGAATTTGAGG + Intergenic
1187375825 X:18753210-18753232 GAGTCTGTTTTGGTAATTTGTGG + Intronic
1190848192 X:54213892-54213914 GGGTGAGTTTCGGTAGTTTGTGG - Intronic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195880581 X:109588793-109588815 GGCTGTGGCAAGGTAAATTGAGG - Intergenic