ID: 1023002809

View in Genome Browser
Species Human (GRCh38)
Location 7:35828960-35828982
Sequence GACACTAGAGAGTTTTTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023002809_1023002812 21 Left 1023002809 7:35828960-35828982 CCTATGAAAAACTCTCTAGTGTC 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1023002812 7:35829004-35829026 CATCCATATACTTCCTACTTTGG 0: 1
1: 0
2: 1
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023002809 Original CRISPR GACACTAGAGAGTTTTTCAT AGG (reversed) Intronic
901970063 1:12901053-12901075 GAAACTAGACATTTGTTCATTGG - Intronic
902015108 1:13300728-13300750 GAAACTAGACATTTGTTCATTGG + Intergenic
902029567 1:13411935-13411957 AACACTAGAGACTTTTTCTCTGG + Intronic
903783766 1:25842000-25842022 GCCATTATAGAGTTCTTCATTGG - Intronic
906036316 1:42752295-42752317 GACACCATAGAACTTTTCATTGG + Exonic
906299048 1:44668495-44668517 GACACTAGAAAGTTTTTCTGGGG - Intronic
907927463 1:58968000-58968022 GCTACTAGAAAGTTTTTCCTTGG - Intergenic
911943395 1:104074887-104074909 AAGGCTAGAGAATTTTTCATGGG - Intergenic
917112082 1:171558755-171558777 GCCACCAGAGAGTTATTAATCGG - Intronic
917443534 1:175087645-175087667 TACACCAGGGAGTTTTCCATCGG + Intronic
918931686 1:190863121-190863143 GAGACTAGAGAAAATTTCATGGG + Intergenic
918999489 1:191811795-191811817 GAAACTAAAGTATTTTTCATTGG + Intergenic
919248980 1:195028684-195028706 GAAACTAGAGACTTTTGCAGAGG + Intergenic
920212154 1:204335985-204336007 GACACTAGAGAAGTTTACATTGG - Intronic
921303951 1:213777337-213777359 GCCACTATAGGGTTGTTCATTGG + Intergenic
1063927558 10:10995452-10995474 ATCACTGGAGAGTTTTGCATTGG + Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1064906348 10:20350052-20350074 GACAGTAGACATTTTTTCAAAGG + Intergenic
1066499529 10:35976632-35976654 AACACAAGAGAATATTTCATGGG - Intergenic
1071685016 10:87745300-87745322 TGCACTGGAGAGTTTTTCAAAGG - Intronic
1071792426 10:88969269-88969291 GACACTAAAGAGCTTTTTTTGGG - Intronic
1073590354 10:104751520-104751542 GACACTGGAGAGTTTAGGATAGG + Intronic
1073781081 10:106839089-106839111 GACATTGTAGAGTTATTCATTGG - Intronic
1078701486 11:13688585-13688607 GGCACCAGAAAGTTTTCCATAGG - Intronic
1080201451 11:29675977-29675999 GATACTAGATAGGATTTCATAGG + Intergenic
1081071615 11:38616908-38616930 GACATTGTAGAGTTTTTAATTGG + Intergenic
1081981305 11:47269010-47269032 GACAGTGGAGAATTTTTCTTGGG - Intronic
1085229854 11:74956912-74956934 GACACTCCAGATTTTCTCATGGG + Intronic
1086213825 11:84353002-84353024 TACACTAGATATTTTTCCATGGG + Intronic
1087538192 11:99479484-99479506 GAAACTAGATAATTTTTCTTGGG + Intronic
1088462837 11:110100808-110100830 GCCATTACAGAGTTATTCATTGG - Intronic
1095453329 12:42354759-42354781 GAAAGTAGCAAGTTTTTCATTGG + Intronic
1095523090 12:43091722-43091744 GACACTATAGGGTTATTAATTGG - Intergenic
1095676108 12:44920047-44920069 GAAACTGGAGAGCTTTTCAAAGG + Intronic
1099558611 12:84144547-84144569 GACACTAAATATATTTTCATGGG + Intergenic
1099922707 12:88978967-88978989 GAAAAAAGAGAGTTTTTCAGGGG + Intergenic
1100215760 12:92446591-92446613 GATGCTAGAGAGTTTTTAACTGG - Intergenic
1106964954 13:35052674-35052696 GACACAAATGAGTTTTTCAATGG - Intronic
1107546821 13:41441294-41441316 GAAACTTAAGAGTTCTTCATTGG + Intergenic
1109678325 13:65711303-65711325 TAGACTACAGTGTTTTTCATAGG - Intergenic
1110013766 13:70372897-70372919 GAAACTATTGATTTTTTCATTGG + Intergenic
1111569457 13:90063296-90063318 GACACTAGTGAAGTTTTCATAGG + Intergenic
1114073801 14:19139100-19139122 GACACAAGTGAGTTTTTCAATGG - Intergenic
1114088463 14:19260885-19260907 GACACAAGTGAGTTTTTCAATGG + Intergenic
1114356841 14:21919256-21919278 GACACTAAGGGGTTATTCATAGG - Intergenic
1115269606 14:31537253-31537275 GACAATACAGAGTTTTTCATGGG - Intronic
1116486660 14:45458013-45458035 AACATTAAAGATTTTTTCATAGG + Intergenic
1122065381 14:99169851-99169873 GGCATTAGAGGGTCTTTCATGGG - Exonic
1124947736 15:34285932-34285954 GAAAATGGAGAGTTGTTCATTGG + Intronic
1130666865 15:85877160-85877182 GACATTAGGGATTTTATCATCGG - Intergenic
1134892704 16:17855043-17855065 GACACAAGACAGTTTGTCTTGGG + Intergenic
1135166855 16:20146842-20146864 GACACTTGAGTGTCTTACATTGG - Intergenic
1138667856 16:58586930-58586952 GAAAATAGAGAGTTGTTGATGGG + Intronic
1138978270 16:62235412-62235434 GAAACAAGAGAGTTTTACTTAGG - Intergenic
1144006406 17:11104046-11104068 GGCAATAAAGAGTCTTTCATAGG - Intergenic
1149962866 17:61131265-61131287 GACATTAGAGAGTTCTTACTTGG + Intronic
1154461751 18:14596829-14596851 AGCACAAGAGAGTTTTGCATTGG - Intergenic
1156911711 18:42418062-42418084 GACACAATGGAGTATTTCATTGG - Intergenic
1158011812 18:52737355-52737377 CACAGTAGAGTTTTTTTCATTGG - Intronic
1158050986 18:53219687-53219709 GGCACTAGAAACTTTTTCTTCGG - Intronic
1159771838 18:72555352-72555374 GAAACTAGATAGTTTTTGAGGGG + Intronic
1164194389 19:22943011-22943033 GAAACTAGGGACTTTTTTATGGG - Intergenic
925253238 2:2460464-2460486 GACTCTAGTGACTTTTTCACAGG + Intergenic
925257356 2:2501575-2501597 GTGACTAGAGAGTGTTTCAAAGG - Intergenic
927323622 2:21777769-21777791 GACACTAGAGAGCTTACCCTGGG - Intergenic
927337710 2:21944437-21944459 CAATCCAGAGAGTTTTTCATGGG - Intergenic
928696017 2:33851068-33851090 GCCAATAGAGAGCTGTTCATAGG - Intergenic
928922811 2:36542794-36542816 CACACATGAGAGTTTTTCAGTGG + Intronic
930161275 2:48158762-48158784 TACACTAAAGAATGTTTCATGGG - Intergenic
933398956 2:81766621-81766643 GACAGAAGTCAGTTTTTCATTGG + Intergenic
935683638 2:105662777-105662799 GAGCCTGGAGAGTTTTTCCTGGG + Intergenic
936961721 2:118082102-118082124 GGTACAAGAGAGTTTTTCCTAGG - Intergenic
938208584 2:129444678-129444700 GTCACTAGACACCTTTTCATAGG - Intergenic
938487738 2:131730482-131730504 GACACAAGTGAGTTTTTCAATGG - Intronic
938821161 2:134961595-134961617 TACACCAGAGATTTTTTAATTGG + Intergenic
940617265 2:156064452-156064474 AGCAGTGGAGAGTTTTTCATTGG - Intergenic
941133844 2:161688190-161688212 GAGAATGAAGAGTTTTTCATTGG - Intronic
941528912 2:166640396-166640418 AAAACTAGAGAGTGTTTCAAGGG - Intergenic
947042055 2:225933969-225933991 GCCACTAAAGAGTATTACATTGG + Intergenic
1172498686 20:35409046-35409068 GACTATAGAGAGTTATTAATAGG + Intronic
1174520074 20:51122503-51122525 AACACTAGAGAGTCTTTGTTGGG - Intergenic
1175880373 20:62254528-62254550 GACACTGGAGAGTCTCTCAGGGG + Intronic
1176812803 21:13561762-13561784 AGCACAAGAGAGTTTTGCATTGG + Intergenic
1178440276 21:32592957-32592979 CACACTAGGAAGTTTTTAATAGG - Intronic
1180492248 22:15861452-15861474 GACACAAGTGAGTTTTTCAATGG - Intergenic
1180578036 22:16798877-16798899 CACAGTAGGGAGTTTTTCTTAGG - Intronic
949367455 3:3298457-3298479 CACTCTAGACAGTTTTTAATGGG - Intergenic
953345577 3:42172573-42172595 ACCACTAGAGAGTTTTTGAAGGG - Intronic
955969818 3:64427137-64427159 GCCACTGGAGGGTTTTTAATTGG - Intronic
956908055 3:73787426-73787448 AACACCAGAGTGTTTTTCAAGGG - Intergenic
962193057 3:133331496-133331518 CACACTGGATAGTTTGTCATTGG - Intronic
966697566 3:182807148-182807170 GAACCTAGAGAGTTTTTCCAGGG + Intronic
971636362 4:29064186-29064208 GACATTAGAGTGCATTTCATTGG + Intergenic
972200211 4:36705125-36705147 AAAAATAGAGAGTTTTTAATAGG + Intergenic
972843028 4:42953905-42953927 GACACTAGTGCCTATTTCATGGG - Intronic
976508756 4:85882702-85882724 GAGAATAGAGAGGTTCTCATAGG + Intronic
977327538 4:95595027-95595049 TACTCTAGAAAGTTTTTTATTGG + Intergenic
977683888 4:99825664-99825686 GACTCTAGAGAATCTTTCTTTGG + Intronic
977725503 4:100292135-100292157 GACACTAGAGATGCTGTCATTGG - Intergenic
977825607 4:101527908-101527930 GTCACTAGAGAGTTTTTCTAGGG + Intronic
979355704 4:119701450-119701472 GACACTTGATATTTTCTCATAGG - Intergenic
982227492 4:153179729-153179751 GACACCTGAGAGTTTTTAAAGGG + Intronic
984616517 4:181904587-181904609 GAGACTTGAGAGTTTTCCAGGGG - Intergenic
987371797 5:17200408-17200430 GAAATTAGATAGTTTTACATGGG + Intronic
987480593 5:18451904-18451926 AACACTAGAGAGTAATTCAAAGG - Intergenic
994331216 5:98508586-98508608 GAGACCAGAGAGGATTTCATAGG - Intergenic
996594327 5:125184193-125184215 GACTCTATAGAGTTTTAGATTGG - Intergenic
996632771 5:125655815-125655837 GGCAATAGAGAGTTTTTATTAGG - Intergenic
997850614 5:137329499-137329521 AACAGTAGAGATTTTTTTATGGG + Intronic
1000496117 5:161987508-161987530 TACAATAGTGATTTTTTCATTGG - Intergenic
1000711218 5:164581411-164581433 GACACTAGAGAGATTTCTAAAGG - Intergenic
1000977145 5:167777583-167777605 GACACTATAGAGAATTTCAAGGG - Intronic
1002161675 5:177317714-177317736 GTCAATAGAGAGCTGTTCATAGG + Intergenic
1004464759 6:15874294-15874316 GACCCTACAGAGTTATTAATTGG - Intergenic
1005917393 6:30365311-30365333 GACACTAGAGAGTTTGGGACAGG - Intergenic
1008558702 6:52701821-52701843 GATACTGGAGTGTTTTTGATAGG + Intergenic
1012654681 6:101801258-101801280 GTCACTTGAAAGTTTTTCTTTGG + Intronic
1014625233 6:123716715-123716737 CACAGTATAGAGTCTTTCATTGG - Intergenic
1015563988 6:134546857-134546879 GACACTGTAGGGATTTTCATGGG + Intergenic
1017953811 6:159161357-159161379 GAGTTTAGAGAGTTTTTCCTGGG + Intergenic
1018252136 6:161881828-161881850 GACACTAGTGGGTTTGCCATCGG - Intronic
1022889351 7:34680886-34680908 GACAGAATAGAGTTTTACATGGG + Intronic
1023002809 7:35828960-35828982 GACACTAGAGAGTTTTTCATAGG - Intronic
1025804377 7:64816735-64816757 GACACAATATAGTTTTGCATTGG + Intronic
1030490226 7:110223558-110223580 GACACCATAGAATGTTTCATAGG + Intergenic
1032197556 7:129798379-129798401 GAGCCTAGAAAGTTCTTCATGGG + Intergenic
1033039149 7:137902485-137902507 GACAGTAAAGAGACTTTCATAGG + Intronic
1033526991 7:142225950-142225972 CACATTAGTGAGTTTTTCAGAGG - Intergenic
1038307808 8:26420538-26420560 GTCACTAGAGAGTTTTAAATAGG + Intronic
1038864849 8:31428822-31428844 GTCAGTAGAGATTCTTTCATTGG + Intergenic
1039181618 8:34873202-34873224 AACACTAAAGAGTTTTAGATAGG - Intergenic
1040730137 8:50434891-50434913 GAAACTAAAGAGATTATCATTGG - Intronic
1040809047 8:51430026-51430048 GACACTGGAGACTTCTTGATTGG - Intronic
1040960657 8:53028789-53028811 GAAACTAGAGAATTTTCCCTTGG + Intergenic
1042188018 8:66156242-66156264 GACTCTACAGAGTTTCTCCTGGG + Intronic
1045256194 8:100524831-100524853 GACAGTAGAAAGCATTTCATTGG - Intronic
1048099965 8:131340559-131340581 TTCACTAGAGATATTTTCATTGG - Intergenic
1056029767 9:82540760-82540782 GTCACTTAAGAGTTTGTCATCGG - Intergenic
1056616338 9:88170027-88170049 ATCAATAGATAGTTTTTCATTGG - Intergenic
1060479483 9:124009551-124009573 GACGCTAGAGTGTTTGTCCTTGG - Intronic
1061529533 9:131199254-131199276 GCCACCAGAGTGTGTTTCATGGG + Intronic
1186146509 X:6629891-6629913 TACACTAGAGAGATTTTCCAGGG - Intergenic
1187279089 X:17843473-17843495 GACATTAGACAGTTCTTCCTTGG - Intronic
1189253416 X:39619118-39619140 GAGACTAGAGAGGTTTACACTGG + Intergenic
1189743437 X:44144869-44144891 GCCACTGTGGAGTTTTTCATCGG + Intergenic
1190577648 X:51856975-51856997 GACACTGGGGAGGTTCTCATGGG + Intronic
1192038756 X:67594650-67594672 CACATCAGAGAGTTTTTCATTGG - Intronic
1193216684 X:78872893-78872915 TAAACTAGAAAGTTTTGCATGGG + Intergenic
1201603781 Y:15762668-15762690 GACACTAGGAAGAGTTTCATGGG + Intergenic