ID: 1023006730

View in Genome Browser
Species Human (GRCh38)
Location 7:35878272-35878294
Sequence AAGGAGAAGGAGGATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023006721_1023006730 14 Left 1023006721 7:35878235-35878257 CCAGTGTCCTAAAGGATGAATAG 0: 2
1: 0
2: 0
3: 22
4: 157
Right 1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG No data
1023006723_1023006730 7 Left 1023006723 7:35878242-35878264 CCTAAAGGATGAATAGGAATTAG 0: 2
1: 3
2: 17
3: 91
4: 458
Right 1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023006730 Original CRISPR AAGGAGAAGGAGGATGAGAA TGG Intronic
No off target data available for this crispr