ID: 1023013554

View in Genome Browser
Species Human (GRCh38)
Location 7:35943927-35943949
Sequence AACCATTGGCTGATGAGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 102}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023013554_1023013558 -8 Left 1023013554 7:35943927-35943949 CCCTTACTCATCAGCCAATGGTT 0: 3
1: 0
2: 1
3: 7
4: 102
Right 1023013558 7:35943942-35943964 CAATGGTTCCGACTGGAGAGAGG 0: 2
1: 0
2: 2
3: 8
4: 106
1023013554_1023013563 9 Left 1023013554 7:35943927-35943949 CCCTTACTCATCAGCCAATGGTT 0: 3
1: 0
2: 1
3: 7
4: 102
Right 1023013563 7:35943959-35943981 GAGAGGGAGGGTGCTCATCATGG 0: 1
1: 1
2: 3
3: 20
4: 259
1023013554_1023013561 -3 Left 1023013554 7:35943927-35943949 CCCTTACTCATCAGCCAATGGTT 0: 3
1: 0
2: 1
3: 7
4: 102
Right 1023013561 7:35943947-35943969 GTTCCGACTGGAGAGAGGGAGGG 0: 1
1: 1
2: 2
3: 13
4: 200
1023013554_1023013560 -4 Left 1023013554 7:35943927-35943949 CCCTTACTCATCAGCCAATGGTT 0: 3
1: 0
2: 1
3: 7
4: 102
Right 1023013560 7:35943946-35943968 GGTTCCGACTGGAGAGAGGGAGG 0: 2
1: 0
2: 1
3: 13
4: 178
1023013554_1023013565 26 Left 1023013554 7:35943927-35943949 CCCTTACTCATCAGCCAATGGTT 0: 3
1: 0
2: 1
3: 7
4: 102
Right 1023013565 7:35943976-35943998 TCATGGATGATGAAGCTCTCGGG 0: 3
1: 1
2: 0
3: 33
4: 162
1023013554_1023013566 27 Left 1023013554 7:35943927-35943949 CCCTTACTCATCAGCCAATGGTT 0: 3
1: 0
2: 1
3: 7
4: 102
Right 1023013566 7:35943977-35943999 CATGGATGATGAAGCTCTCGGGG 0: 2
1: 0
2: 1
3: 7
4: 100
1023013554_1023013564 25 Left 1023013554 7:35943927-35943949 CCCTTACTCATCAGCCAATGGTT 0: 3
1: 0
2: 1
3: 7
4: 102
Right 1023013564 7:35943975-35943997 ATCATGGATGATGAAGCTCTCGG 0: 2
1: 1
2: 1
3: 18
4: 163
1023013554_1023013559 -7 Left 1023013554 7:35943927-35943949 CCCTTACTCATCAGCCAATGGTT 0: 3
1: 0
2: 1
3: 7
4: 102
Right 1023013559 7:35943943-35943965 AATGGTTCCGACTGGAGAGAGGG 0: 2
1: 1
2: 0
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023013554 Original CRISPR AACCATTGGCTGATGAGTAA GGG (reversed) Intergenic
902099391 1:13973405-13973427 AACCACTGGCAGAAGAGTAGAGG + Intergenic
906772283 1:48495807-48495829 AAACAATGGCTGATGAGAACAGG - Intergenic
910668224 1:89746980-89747002 AGCCAATGGATGGTGAGTAAAGG + Intronic
910861467 1:91746427-91746449 TAACATTGGCAGATGAGGAAGGG - Intronic
911716920 1:101143681-101143703 AACTATTTGGGGATGAGTAATGG - Intergenic
912653954 1:111468861-111468883 TTCAATGGGCTGATGAGTAATGG - Intergenic
913986136 1:143567833-143567855 AACTATTGGAGGATGAATAATGG - Intergenic
922297742 1:224266395-224266417 AACCATGGTCCCATGAGTAAAGG - Intronic
922358981 1:224803705-224803727 AAACACTGGGAGATGAGTAATGG + Intergenic
923148785 1:231216081-231216103 CACAATTGGCTGATTAATAAAGG - Exonic
1064152825 10:12879153-12879175 AACTATTGACTGAGGAGTATGGG + Intergenic
1065495089 10:26319376-26319398 ACCCATAGGCTGAGGAATAAGGG - Intergenic
1066243904 10:33563461-33563483 CACCATCAGCTGATGAGAAAAGG + Intergenic
1071024543 10:81097124-81097146 AACCATATGCAGAAGAGTAAAGG - Intergenic
1071734776 10:88286163-88286185 AACCATGGGATGAGGAGTAGTGG - Intronic
1081312944 11:41595241-41595263 AAACATTGGCTCATTTGTAAAGG + Intergenic
1085223360 11:74895442-74895464 CACCATTGGCTGAAGTGCAATGG + Intronic
1086938223 11:92767344-92767366 AATCAGTGGCTGATGAGAAAGGG - Intronic
1086999133 11:93395255-93395277 ATCCATTTGATCATGAGTAAGGG - Intronic
1100645234 12:96522574-96522596 AACCTAAGGCTGATGAGAAAAGG - Intronic
1102593262 12:113973438-113973460 AGACATAGGCTGATGAGTGAGGG - Intergenic
1107444090 13:40454502-40454524 AACCATTGGCAGATTTCTAAGGG - Intergenic
1109811434 13:67518239-67518261 AAACATCAGGTGATGAGTAAAGG + Intergenic
1112030575 13:95453044-95453066 AACCATTGCATGCTGATTAAGGG - Intronic
1113355820 13:109578955-109578977 AACCATTGTCTGATGTGGAGGGG + Intergenic
1113815939 13:113171259-113171281 AAACATTGGCTGTTGAGAAGTGG - Intronic
1117552807 14:56852769-56852791 AACCCTTGGCTGATGACCAGAGG - Intergenic
1118346729 14:64946495-64946517 AATCACTGGCTAATGAGAAAAGG - Exonic
1118787734 14:69060138-69060160 CTCCTTTGGCTGATGACTAATGG - Intronic
1121058316 14:90879490-90879512 AACCAATGGCTGATGGGTCCAGG + Intronic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1123463560 15:20496222-20496244 AAATATTTGCAGATGAGTAAAGG + Intergenic
1123654502 15:22504203-22504225 AAATATTTGCAGATGAGTAAAGG - Intergenic
1124274404 15:28313620-28313642 AAATATTTGCAGATGAGTAAAGG + Intronic
1124308412 15:28599399-28599421 AAATATTTGCAGATGAGTAAAGG - Intergenic
1127799682 15:62467085-62467107 GACCATTGCCTTATGAGTTACGG + Intronic
1131336429 15:91553614-91553636 AACCAGTGGGTGATTAGGAAAGG + Intergenic
1131812704 15:96189482-96189504 AACCATTTGCAGGTGTGTAAAGG + Intergenic
1133868196 16:9663652-9663674 AACAGTTGAGTGATGAGTAATGG + Intergenic
1134787331 16:16956485-16956507 AACCAATGACTGCTGAGTGAAGG - Intergenic
1135935106 16:26773223-26773245 CAGCATTGGCTGATGAGAAGTGG + Intergenic
1137923345 16:52514370-52514392 AAGCATTGGCTTATGATTCATGG - Intronic
1144514014 17:15902565-15902587 AAATATTGGCTGATGATAAATGG - Intergenic
1150849408 17:68690242-68690264 GACCCTTGGCTGATGAGGAATGG + Intergenic
1155790441 18:29961512-29961534 AACCATTTGCTGAACAATAAAGG - Intergenic
1155912298 18:31517929-31517951 AACCATAGGATGCGGAGTAAAGG + Intronic
1156513393 18:37660256-37660278 CACAAGTGGCTGATTAGTAAGGG - Intergenic
1158202058 18:54952136-54952158 AATAATTGGCTGATGGGTTAAGG - Intronic
925028505 2:628673-628695 AACAATTGAAAGATGAGTAAAGG + Intergenic
925777332 2:7347964-7347986 AACCATTGTCTGCTGAGGGAGGG + Intergenic
926331919 2:11832645-11832667 AACCATTGGCTGATGTATAAAGG + Intergenic
928006323 2:27565396-27565418 AACCTTGAGCTGAAGAGTAAAGG - Exonic
941703351 2:168629766-168629788 AACCATTGAGAGATTAGTAATGG + Intronic
942393104 2:175516951-175516973 ATCAATTGGCTGATGAATAAAGG + Intergenic
942970997 2:181957778-181957800 CAACATTGGCTGATGAGTATGGG - Intronic
943903543 2:193471075-193471097 ATCCCTTGGCTGATAGGTAATGG - Intergenic
948336321 2:237210087-237210109 ATCCAAATGCTGATGAGTAAAGG + Intergenic
1169210593 20:3764328-3764350 CACCAGTGGCTGGTGAGCAAAGG + Intronic
1170492195 20:16888832-16888854 GACCATTAGCTAATGAGGAAAGG + Intergenic
1178553685 21:33566660-33566682 AAAGATACGCTGATGAGTAAAGG + Intronic
1181575366 22:23790967-23790989 AGCATTTGGCAGATGAGTAAAGG + Intronic
1182128630 22:27834721-27834743 AAGGATTGGCTGATGATAAAGGG - Intergenic
1184481431 22:44750260-44750282 AGCCATTGACTGATGTGAAATGG - Intronic
951794779 3:26526059-26526081 ATCTATTGGCAGATGAGGAAGGG + Intergenic
953055057 3:39381456-39381478 ACCCATTGGCAGATGAGTGGGGG - Intergenic
953222500 3:40985612-40985634 AACCAATGGCTAATGAGTGTGGG - Intergenic
954703776 3:52467456-52467478 AACGGTGGGCTCATGAGTAAAGG - Intronic
961155069 3:124672540-124672562 ATCTATTGGCTGATGTGGAAGGG + Intronic
962992295 3:140589273-140589295 AAAGATTGTCTGATAAGTAAGGG + Intergenic
964186663 3:153953573-153953595 CACCATTGGGTGAAGAGTACAGG + Intergenic
968617606 4:1586089-1586111 ATCCATTGACAGATGAATAAAGG - Intergenic
974331459 4:60484125-60484147 AACCAGTGGCTTATAAATAAGGG - Intergenic
978219114 4:106248186-106248208 AACCAATTGCTTATGCGTAAAGG + Intronic
980104084 4:128570525-128570547 AGCCATTGGCTGATGAGGCATGG - Intergenic
980188053 4:129487806-129487828 AATCATTGGCCGATGATCAATGG - Intergenic
981009909 4:139914993-139915015 AACCAGTGGCTAAGGAGAAAGGG + Intronic
981434222 4:144700923-144700945 AACTATTTGCTGATCAGAAATGG - Intronic
981563786 4:146076258-146076280 ATCAATTGGCTGATTATTAATGG + Intergenic
981855230 4:149281548-149281570 AACTATTGGATGATCAGAAAAGG + Intergenic
983142895 4:164174854-164174876 AACAATTAGCTAATTAGTAATGG - Intronic
983722687 4:170876190-170876212 AGCCAATGGCTGATGAGTTGGGG + Intergenic
983896994 4:173091665-173091687 CACCATTGACTGATGAGAGAAGG + Intergenic
987045642 5:14105250-14105272 CACCATTGACTGATGAGCAATGG + Intergenic
993288424 5:86032393-86032415 AACAATTCTCTCATGAGTAAAGG - Intergenic
999213947 5:149915891-149915913 AAGTTTTGACTGATGAGTAATGG - Intronic
1001057365 5:168460834-168460856 AGCCAGTGGCTGAGGAGAAATGG - Intronic
1008037387 6:46760368-46760390 AATCATGGGCTTATGAGTAATGG + Intergenic
1012276473 6:97281064-97281086 CAGCAATGCCTGATGAGTAATGG - Intronic
1016362831 6:143286597-143286619 AACCTTTGGCTGTTGTGTCACGG - Intronic
1017519675 6:155190787-155190809 AACTATTGGCTGCTGAGAAGAGG + Intronic
1020347885 7:7183897-7183919 AATAATTGGCCGATGTGTAAGGG + Intronic
1022982542 7:35617997-35618019 ACCCATAGGCTGATGATGAAGGG - Intergenic
1023013554 7:35943927-35943949 AACCATTGGCTGATGAGTAAGGG - Intergenic
1023675011 7:42619903-42619925 CACCAATGGCACATGAGTAAAGG - Intergenic
1024077574 7:45829907-45829929 AACCATTGGCTGATGAGTAAGGG + Intergenic
1025126839 7:56351505-56351527 AACCATTGGCTGATGAGTAAGGG - Intergenic
1026246477 7:68624731-68624753 AACCAATAGCTGATGGGTAGGGG + Intergenic
1029557215 7:101278796-101278818 AATCATCAGCTGATGAATAAGGG - Intergenic
1029793720 7:102872010-102872032 AACCAATGGGTGATGTGTAGGGG - Intronic
1031538126 7:122960101-122960123 TACAATTGGAAGATGAGTAAGGG + Intergenic
1036047034 8:5154646-5154668 AACCTTAGGCTGAAGAGAAATGG + Intergenic
1039069867 8:33640085-33640107 AACCACTTACTGATGAGGAAGGG + Intergenic
1039303373 8:36234519-36234541 AACCATTGACTTATGAAAAATGG + Intergenic
1039779428 8:40769896-40769918 ACCCATTGGCTGAAAAGGAAAGG + Intronic
1043424541 8:80135477-80135499 AACCAGTGCCTTAAGAGTAAGGG - Intronic
1046379139 8:113431268-113431290 CTCCTTTGGATGATGAGTAAAGG + Intronic
1051806742 9:21002572-21002594 AACCATTGCTTAATGAGTATAGG + Exonic
1186855688 X:13624005-13624027 AACCCTGCTCTGATGAGTAATGG - Intronic
1188287581 X:28346880-28346902 CACCATTGGATGAGGAGGAAAGG + Intergenic
1189728242 X:43990515-43990537 AACCAATGACTGATGGGTACAGG + Intergenic
1192295364 X:69842076-69842098 AGCAATGGGCGGATGAGTAAGGG + Intronic
1197163628 X:123351540-123351562 AACCATAGCCTGATGACTTAGGG + Intronic
1201066446 Y:10100337-10100359 AGCCAATGGATGATCAGTAATGG + Intergenic