ID: 1023026816

View in Genome Browser
Species Human (GRCh38)
Location 7:36058321-36058343
Sequence TGTCCCTCCCTCACTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023026812_1023026816 5 Left 1023026812 7:36058293-36058315 CCTCTGACATTGAAAGGTGACCT No data
Right 1023026816 7:36058321-36058343 TGTCCCTCCCTCACTGTGGGAGG No data
1023026811_1023026816 6 Left 1023026811 7:36058292-36058314 CCCTCTGACATTGAAAGGTGACC No data
Right 1023026816 7:36058321-36058343 TGTCCCTCCCTCACTGTGGGAGG No data
1023026810_1023026816 7 Left 1023026810 7:36058291-36058313 CCCCTCTGACATTGAAAGGTGAC No data
Right 1023026816 7:36058321-36058343 TGTCCCTCCCTCACTGTGGGAGG No data
1023026807_1023026816 18 Left 1023026807 7:36058280-36058302 CCCTGTGGCTGCCCCTCTGACAT No data
Right 1023026816 7:36058321-36058343 TGTCCCTCCCTCACTGTGGGAGG No data
1023026808_1023026816 17 Left 1023026808 7:36058281-36058303 CCTGTGGCTGCCCCTCTGACATT No data
Right 1023026816 7:36058321-36058343 TGTCCCTCCCTCACTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023026816 Original CRISPR TGTCCCTCCCTCACTGTGGG AGG Intergenic
No off target data available for this crispr