ID: 1023028670

View in Genome Browser
Species Human (GRCh38)
Location 7:36074482-36074504
Sequence TGCCACAGGCTGACAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023028670_1023028676 0 Left 1023028670 7:36074482-36074504 CCAGGCCCTGTCAGCCTGTGGCA No data
Right 1023028676 7:36074505-36074527 CCTGCTGCCCTATCAGGTCCAGG No data
1023028670_1023028686 26 Left 1023028670 7:36074482-36074504 CCAGGCCCTGTCAGCCTGTGGCA No data
Right 1023028686 7:36074531-36074553 CCAGGGGCAGTCCTCTGTGGAGG No data
1023028670_1023028679 8 Left 1023028670 7:36074482-36074504 CCAGGCCCTGTCAGCCTGTGGCA No data
Right 1023028679 7:36074513-36074535 CCTATCAGGTCCAGGAGCCCAGG No data
1023028670_1023028683 23 Left 1023028670 7:36074482-36074504 CCAGGCCCTGTCAGCCTGTGGCA No data
Right 1023028683 7:36074528-36074550 AGCCCAGGGGCAGTCCTCTGTGG No data
1023028670_1023028681 10 Left 1023028670 7:36074482-36074504 CCAGGCCCTGTCAGCCTGTGGCA No data
Right 1023028681 7:36074515-36074537 TATCAGGTCCAGGAGCCCAGGGG No data
1023028670_1023028680 9 Left 1023028670 7:36074482-36074504 CCAGGCCCTGTCAGCCTGTGGCA No data
Right 1023028680 7:36074514-36074536 CTATCAGGTCCAGGAGCCCAGGG No data
1023028670_1023028674 -6 Left 1023028670 7:36074482-36074504 CCAGGCCCTGTCAGCCTGTGGCA No data
Right 1023028674 7:36074499-36074521 GTGGCACCTGCTGCCCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023028670 Original CRISPR TGCCACAGGCTGACAGGGCC TGG (reversed) Intergenic
No off target data available for this crispr