ID: 1023030245

View in Genome Browser
Species Human (GRCh38)
Location 7:36084725-36084747
Sequence ACTCCAGCAGTGGAGCCGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023030245_1023030249 24 Left 1023030245 7:36084725-36084747 CCTCACGGCTCCACTGCTGGAGT 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1023030249 7:36084772-36084794 AGCCCATCCACACTGGCCGCTGG 0: 1
1: 0
2: 0
3: 14
4: 132
1023030245_1023030252 27 Left 1023030245 7:36084725-36084747 CCTCACGGCTCCACTGCTGGAGT 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG 0: 1
1: 0
2: 0
3: 10
4: 142
1023030245_1023030248 17 Left 1023030245 7:36084725-36084747 CCTCACGGCTCCACTGCTGGAGT 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1023030248 7:36084765-36084787 AACACTGAGCCCATCCACACTGG 0: 1
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023030245 Original CRISPR ACTCCAGCAGTGGAGCCGTG AGG (reversed) Exonic