ID: 1023030246 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:36084735-36084757 |
Sequence | TGGATCATTAACTCCAGCAG TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 112 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 103} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1023030246_1023030254 | 21 | Left | 1023030246 | 7:36084735-36084757 | CCACTGCTGGAGTTAATGATCCA | 0: 1 1: 0 2: 0 3: 8 4: 103 |
||
Right | 1023030254 | 7:36084779-36084801 | CCACACTGGCCGCTGGCGGATGG | 0: 1 1: 0 2: 0 3: 10 4: 110 |
||||
1023030246_1023030248 | 7 | Left | 1023030246 | 7:36084735-36084757 | CCACTGCTGGAGTTAATGATCCA | 0: 1 1: 0 2: 0 3: 8 4: 103 |
||
Right | 1023030248 | 7:36084765-36084787 | AACACTGAGCCCATCCACACTGG | 0: 1 1: 0 2: 0 3: 12 4: 155 |
||||
1023030246_1023030249 | 14 | Left | 1023030246 | 7:36084735-36084757 | CCACTGCTGGAGTTAATGATCCA | 0: 1 1: 0 2: 0 3: 8 4: 103 |
||
Right | 1023030249 | 7:36084772-36084794 | AGCCCATCCACACTGGCCGCTGG | 0: 1 1: 0 2: 0 3: 14 4: 132 |
||||
1023030246_1023030252 | 17 | Left | 1023030246 | 7:36084735-36084757 | CCACTGCTGGAGTTAATGATCCA | 0: 1 1: 0 2: 0 3: 8 4: 103 |
||
Right | 1023030252 | 7:36084775-36084797 | CCATCCACACTGGCCGCTGGCGG | 0: 1 1: 0 2: 0 3: 10 4: 142 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1023030246 | Original CRISPR | TGGATCATTAACTCCAGCAG TGG (reversed) | Exonic | ||