ID: 1023030246

View in Genome Browser
Species Human (GRCh38)
Location 7:36084735-36084757
Sequence TGGATCATTAACTCCAGCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023030246_1023030254 21 Left 1023030246 7:36084735-36084757 CCACTGCTGGAGTTAATGATCCA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1023030254 7:36084779-36084801 CCACACTGGCCGCTGGCGGATGG 0: 1
1: 0
2: 0
3: 10
4: 110
1023030246_1023030248 7 Left 1023030246 7:36084735-36084757 CCACTGCTGGAGTTAATGATCCA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1023030248 7:36084765-36084787 AACACTGAGCCCATCCACACTGG 0: 1
1: 0
2: 0
3: 12
4: 155
1023030246_1023030249 14 Left 1023030246 7:36084735-36084757 CCACTGCTGGAGTTAATGATCCA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1023030249 7:36084772-36084794 AGCCCATCCACACTGGCCGCTGG 0: 1
1: 0
2: 0
3: 14
4: 132
1023030246_1023030252 17 Left 1023030246 7:36084735-36084757 CCACTGCTGGAGTTAATGATCCA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG 0: 1
1: 0
2: 0
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023030246 Original CRISPR TGGATCATTAACTCCAGCAG TGG (reversed) Exonic