ID: 1023030247

View in Genome Browser
Species Human (GRCh38)
Location 7:36084755-36084777
Sequence TGGGCTCAGTGTTTTGCTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023030247_1023030252 -3 Left 1023030247 7:36084755-36084777 CCATGAGCAAAACACTGAGCCCA 0: 1
1: 0
2: 2
3: 22
4: 289
Right 1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG 0: 1
1: 0
2: 0
3: 10
4: 142
1023030247_1023030249 -6 Left 1023030247 7:36084755-36084777 CCATGAGCAAAACACTGAGCCCA 0: 1
1: 0
2: 2
3: 22
4: 289
Right 1023030249 7:36084772-36084794 AGCCCATCCACACTGGCCGCTGG 0: 1
1: 0
2: 0
3: 14
4: 132
1023030247_1023030254 1 Left 1023030247 7:36084755-36084777 CCATGAGCAAAACACTGAGCCCA 0: 1
1: 0
2: 2
3: 22
4: 289
Right 1023030254 7:36084779-36084801 CCACACTGGCCGCTGGCGGATGG 0: 1
1: 0
2: 0
3: 10
4: 110
1023030247_1023030256 26 Left 1023030247 7:36084755-36084777 CCATGAGCAAAACACTGAGCCCA 0: 1
1: 0
2: 2
3: 22
4: 289
Right 1023030256 7:36084804-36084826 ACCGCCATGCTAGATCTGTGCGG 0: 1
1: 0
2: 0
3: 0
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023030247 Original CRISPR TGGGCTCAGTGTTTTGCTCA TGG (reversed) Exonic