ID: 1023030252

View in Genome Browser
Species Human (GRCh38)
Location 7:36084775-36084797
Sequence CCATCCACACTGGCCGCTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023030247_1023030252 -3 Left 1023030247 7:36084755-36084777 CCATGAGCAAAACACTGAGCCCA 0: 1
1: 0
2: 2
3: 22
4: 289
Right 1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG 0: 1
1: 0
2: 0
3: 10
4: 142
1023030245_1023030252 27 Left 1023030245 7:36084725-36084747 CCTCACGGCTCCACTGCTGGAGT 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG 0: 1
1: 0
2: 0
3: 10
4: 142
1023030246_1023030252 17 Left 1023030246 7:36084735-36084757 CCACTGCTGGAGTTAATGATCCA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG 0: 1
1: 0
2: 0
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023030252 Original CRISPR CCATCCACACTGGCCGCTGG CGG Exonic