ID: 1023030252

View in Genome Browser
Species Human (GRCh38)
Location 7:36084775-36084797
Sequence CCATCCACACTGGCCGCTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023030245_1023030252 27 Left 1023030245 7:36084725-36084747 CCTCACGGCTCCACTGCTGGAGT 0: 1
1: 0
2: 0
3: 14
4: 151
Right 1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG 0: 1
1: 0
2: 0
3: 10
4: 142
1023030247_1023030252 -3 Left 1023030247 7:36084755-36084777 CCATGAGCAAAACACTGAGCCCA 0: 1
1: 0
2: 2
3: 22
4: 289
Right 1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG 0: 1
1: 0
2: 0
3: 10
4: 142
1023030246_1023030252 17 Left 1023030246 7:36084735-36084757 CCACTGCTGGAGTTAATGATCCA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG 0: 1
1: 0
2: 0
3: 10
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023030252 Original CRISPR CCATCCACACTGGCCGCTGG CGG Exonic
901229157 1:7632311-7632333 ACCTCCCCACTTGCCGCTGGGGG - Intronic
901678196 1:10898820-10898842 CCTTCCACCCTGGCCTCTGGGGG - Intergenic
902301360 1:15504969-15504991 CCAGGCACACTGGCCCCTAGAGG - Intronic
904997127 1:34639831-34639853 CCAACCACAGTGCCTGCTGGGGG - Intergenic
905307413 1:37029249-37029271 CCTACCACACTGGCCTCTGGAGG + Intronic
905503330 1:38456466-38456488 CCATCCACAATGGCTCCTGACGG - Intergenic
905872190 1:41411300-41411322 TCTTCCACACTGACTGCTGGAGG - Intergenic
907283647 1:53366989-53367011 CCAGCCACACTGGACTCTGTAGG - Intergenic
907311582 1:53541937-53541959 CCATCATCACTGGCCACAGGAGG - Intronic
907533480 1:55126210-55126232 CCAACCACACTGGCCTCCTGTGG + Intronic
910746914 1:90583970-90583992 CCATACACATTTGCCTCTGGAGG - Intergenic
911090176 1:94011508-94011530 GCAGCCAGACTGGCCACTGGAGG + Intronic
911935415 1:103963727-103963749 TCATCCACACTGGCCGGGTGTGG + Intergenic
912211567 1:107562660-107562682 CCAACCACACTGGGCCCTTGTGG + Intergenic
912533064 1:110340204-110340226 CCGACCACACTGGCTGATGGAGG - Exonic
915554274 1:156652736-156652758 CCAGCCACACGGGCCCCTGAGGG + Exonic
922944284 1:229497787-229497809 TCATCCACACAGACAGCTGGAGG + Intronic
1062801511 10:384764-384786 CCATGCACACAGGCCCCTGGAGG + Intronic
1064096020 10:12425061-12425083 CCAGCCACACTGGACGGTGGGGG + Intronic
1067205525 10:44208892-44208914 CCATCCACACTGGGTGAGGGTGG + Intergenic
1069775728 10:70926068-70926090 CCGTCCACACTGCCCGCGTGGGG + Intergenic
1070967305 10:80537420-80537442 CCATTAAAACTGGCCCCTGGAGG + Intergenic
1071485551 10:86099811-86099833 CCATGCACAGGGGCCACTGGTGG + Intronic
1073509928 10:104036551-104036573 CCATCTCCACTGGCTCCTGGTGG + Exonic
1073827062 10:107336479-107336501 CCATCACCACTGGCCCATGGTGG + Intergenic
1074777120 10:116774827-116774849 CCCTCCACCCTGGCCCCTGCAGG + Intergenic
1074939330 10:118219338-118219360 GCAGCCACACTGGCCTCTCGTGG - Intergenic
1075662839 10:124210069-124210091 CCATCCACCCTGGCCTATGGTGG - Intergenic
1077490619 11:2859314-2859336 CCAGCCAGACTGGCCGCTTATGG + Intergenic
1077536052 11:3124756-3124778 CCATTCACACCGGCAGCTGGGGG + Intronic
1079699082 11:23520812-23520834 CCATGCACACAGGCTACTGGAGG + Intergenic
1080239259 11:30107444-30107466 CCATCCACAGTGGCAGAAGGAGG + Intergenic
1080403954 11:31962027-31962049 CCCTGCACACTGTCGGCTGGAGG - Intronic
1080602327 11:33831675-33831697 CCATCCTCCATGGCCCCTGGGGG + Intergenic
1081691031 11:45078699-45078721 CCAGCCAGACTGGCCCATGGCGG + Intergenic
1084274781 11:68045794-68045816 CCACCCACACAGGCCGTTGGGGG + Intronic
1087276631 11:96167390-96167412 CCTTCCACACTGGCCCCCAGAGG + Intronic
1088214700 11:107494898-107494920 CCAGCCACACTGGCCTCCTGCGG + Intergenic
1088764279 11:112961537-112961559 CCGTCCACACTCGCTGCAGGGGG + Exonic
1089328934 11:117676695-117676717 CCACCCACACTGCTTGCTGGGGG - Intronic
1090419514 11:126564548-126564570 CCCTCCACACTGGCGTCTGAAGG + Intronic
1090630112 11:128638246-128638268 CCAACCACATTGCCCGCAGGTGG + Intergenic
1093366180 12:18302377-18302399 CCATTCACACAAGCCACTGGGGG - Intronic
1096812600 12:54181232-54181254 CCCTTCACCCTGGCCGCAGGTGG + Intronic
1102425024 12:112837276-112837298 CCCTCCTCACTGGCTGGTGGTGG + Intronic
1106208908 13:27622646-27622668 CCATCCACACTGGCCACAAGGGG - Intronic
1113726476 13:112606495-112606517 CCACCCACACCGGCCGCCTGAGG + Intergenic
1119644443 14:76338303-76338325 CCAGGCACCCTGGCTGCTGGAGG + Intronic
1119661624 14:76456393-76456415 TCCTCCACACTGCCCCCTGGAGG - Intronic
1121580214 14:95024490-95024512 CCAGCCACACTGGTTGATGGTGG + Intergenic
1121954817 14:98204352-98204374 CCTTCCACTCTGGCCCCTGTAGG - Intergenic
1122996770 14:105269320-105269342 CTATCCCCTCTGGCTGCTGGTGG - Intronic
1124601212 15:31134077-31134099 CCAGCCACACGGGCCTCCGGCGG - Intronic
1127732741 15:61815526-61815548 CCAGCCACACTGGCCTCCTGTGG - Intergenic
1132652778 16:1029058-1029080 CCATCCGGACGGGCCTCTGGAGG + Intergenic
1132677464 16:1126629-1126651 CCATCCAGACTGGCTGCAGAGGG - Intergenic
1133002131 16:2857005-2857027 CCCTCCTCACTGGGCGCTGAGGG - Intronic
1133002148 16:2857052-2857074 CCCTCCTCACTGGGCGCTGAGGG - Intronic
1135841264 16:25878707-25878729 CCTTCCACACCAGCTGCTGGAGG + Intronic
1136223972 16:28846390-28846412 CCATAGACACTGGCGGCTAGAGG - Exonic
1136344268 16:29664851-29664873 CCATCCTCACTGGCCACCAGTGG - Exonic
1140111452 16:72008793-72008815 CCATCCACACTGCTCACTCGCGG - Intronic
1140296870 16:73717410-73717432 CCCTCCTCACTGGTCACTGGAGG + Intergenic
1142032347 16:87844794-87844816 CCAACCACTCTGGCCCCTTGGGG + Intronic
1148469127 17:47882680-47882702 CCAACCCCACTGGCCTCTGAAGG + Intergenic
1151358426 17:73573818-73573840 CCATCCACACAGGCCTTTGCAGG - Intronic
1151548691 17:74808840-74808862 CCATGCACTGTGGCCGCTGCAGG - Intronic
1151970618 17:77455648-77455670 CCATCAACCCCGCCCGCTGGGGG - Intronic
1157293260 18:46424864-46424886 CCTTCCTCACTGGCCTCTGTGGG + Intronic
1158614195 18:58970790-58970812 ACATCCCCACTGGCCAGTGGAGG + Intronic
1160541452 18:79626067-79626089 CGAGCCACACTTGCCTCTGGAGG + Intergenic
1160606969 18:80058827-80058849 CCTTCCACACTGGTCTCTGTGGG - Intronic
1161580918 19:5080548-5080570 CCCTCCTCACTGGCATCTGGTGG - Intronic
1162460541 19:10811609-10811631 CCATGCTCCCTGGCCGCTGGAGG - Intronic
1163441670 19:17325046-17325068 ACATCCTCACTGGCTGCTGCAGG - Exonic
1164542664 19:29132528-29132550 CCATCCACACTGTAAGCTGCTGG + Intergenic
1166256122 19:41606160-41606182 CCATCCACACCTCCTGCTGGAGG - Intronic
1168042649 19:53770528-53770550 ACATCCACACTGGCCTCTCTGGG - Intergenic
1168117841 19:54234152-54234174 CCCTCCAGCCTGGCCCCTGGAGG - Intronic
925157787 2:1660678-1660700 CCCTCCACACAGGCACCTGGAGG - Intronic
925283013 2:2697990-2698012 TCATCCACACTGTGCACTGGAGG + Intergenic
926434771 2:12826620-12826642 CCATCCACACTGGCCTAAGCTGG - Intergenic
926912533 2:17864426-17864448 CTGCCCACACTGGCCTCTGGTGG - Intergenic
928803267 2:35120190-35120212 CCATTCACACTGTCCACTGTTGG - Intergenic
930842215 2:55860117-55860139 CCATACACACTGCCTGCAGGAGG - Intergenic
933232272 2:79822698-79822720 TCATCCTCCCTGGCCGCTAGTGG + Intronic
935729979 2:106057189-106057211 CCACCCACAATGGCTGCAGGGGG + Intergenic
938365399 2:130729471-130729493 CCAGCCACCCAGGCTGCTGGAGG - Exonic
940582465 2:155600041-155600063 CCAGGCACACTGGCTGCTGTGGG + Intergenic
945923484 2:215779893-215779915 CCATCCCCAGTGGACCCTGGTGG - Intergenic
947536813 2:230944940-230944962 CCACCCACACTCGCTGCCGGGGG + Intronic
947696277 2:232192653-232192675 ACTTCCACACTGTCCCCTGGGGG - Intronic
948016191 2:234692728-234692750 GCATCCACACTGGGTCCTGGGGG + Intergenic
1169062548 20:2672178-2672200 CCCTCCACATTGCCCCCTGGAGG + Intergenic
1170524796 20:17226916-17226938 CCGCCCTCATTGGCCGCTGGCGG + Intronic
1170615056 20:17941675-17941697 CCCTCCCTAATGGCCGCTGGGGG - Exonic
1172404387 20:34676892-34676914 CCATTCACAGAGGCCGCGGGAGG + Intronic
1172592997 20:36130714-36130736 CCATTCACCCTGGATGCTGGGGG - Intronic
1172799779 20:37567745-37567767 CCTCCCCCACTGGCGGCTGGCGG + Intergenic
1174185901 20:48706095-48706117 CCAGCAACACTGGCCACTGAGGG + Intronic
1174426754 20:50437158-50437180 CCATTCAGAGTGGCTGCTGGTGG + Intergenic
1176178802 20:63740256-63740278 CCGTCCACACCGGCCGCAGCCGG + Intronic
1180224816 21:46386088-46386110 CCATGCACGCTGGCTCCTGGTGG + Intronic
1181165060 22:20978856-20978878 CCATCCACACTGGTCTCTTTGGG + Intronic
1182484258 22:30629963-30629985 CCCTCCACCCTGGCCACAGGTGG + Intergenic
1184305591 22:43599132-43599154 CCTTCCACAGTGGCCGCAGCAGG + Intronic
1184569617 22:45313794-45313816 CAGTACACACTGGCCGCTTGTGG + Intronic
1184688028 22:46105143-46105165 GCAGCCACCCTGGCCCCTGGGGG - Intronic
1185044047 22:48520129-48520151 CCAGCCACGCTGGAAGCTGGAGG + Intronic
952365790 3:32673842-32673864 CCATCCACAGTGACCCCAGGGGG + Intergenic
954671439 3:52293303-52293325 CCAGCCAGACTGGCAGATGGGGG + Exonic
956156544 3:66304242-66304264 CCATCCACACTGGATGGGGGAGG + Intronic
958497369 3:94862909-94862931 CCATCCACATTGGCAGCAGCTGG - Intergenic
959731411 3:109607543-109607565 CCATCAACACTGGCTGTTGTTGG - Intergenic
966923733 3:184631028-184631050 GCATACAGAATGGCCGCTGGAGG + Intronic
968647548 4:1748148-1748170 CCATCCAGCCTGGTGGCTGGCGG - Intergenic
969345808 4:6569147-6569169 CCACCCACCCTGGCCTATGGTGG - Intergenic
971959767 4:33471008-33471030 CCAACCACTCTGGACACTGGTGG + Intergenic
976221371 4:82759227-82759249 GCAGCCACAGTGGCAGCTGGCGG + Intronic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
985571155 5:646085-646107 CCATCCACACAGGCCGCCAATGG - Intronic
985644202 5:1077437-1077459 CCACACACACTGGCTGCAGGTGG + Intronic
985966368 5:3341641-3341663 CCATGCACACTGGGAGCAGGAGG - Intergenic
985967080 5:3345657-3345679 ACACCCACACTGGTCTCTGGAGG + Intergenic
988470445 5:31532434-31532456 CCACCCACACTGGGAGCTTGGGG - Exonic
992069359 5:73135512-73135534 CCATGAGCACTGGCGGCTGGGGG - Intergenic
996779769 5:127172538-127172560 CCCACCACACTGGCTGATGGAGG + Intergenic
997605442 5:135172760-135172782 GCATCCAGCCTGGCAGCTGGTGG + Intronic
1004281539 6:14283755-14283777 CCATCCACACTGCCCTCTAAGGG - Intergenic
1006417785 6:33914949-33914971 CCCTCCACAGTGGCTGCTGATGG + Intergenic
1007712091 6:43830987-43831009 TCGTCCACCCTGGCCTCTGGGGG - Intergenic
1010938615 6:81889382-81889404 CTAGCCACACTGGCAGCTGAGGG + Intergenic
1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG + Exonic
1017448225 6:154528769-154528791 CCATCCACACTGCAGGGTGGGGG + Intergenic
1019376727 7:696823-696845 CCATACACACAGGCCGCTTCAGG + Intronic
1019797470 7:3062440-3062462 TCATCCACTCTGGCCACTGCTGG - Intergenic
1021652068 7:22842165-22842187 ACATCCTCACTGGCCTCTGCTGG - Intergenic
1023030252 7:36084775-36084797 CCATCCACACTGGCCGCTGGCGG + Exonic
1023937449 7:44749526-44749548 CCATCAAAACTGGCAGCTGGGGG - Intronic
1028177252 7:87672961-87672983 CCATGCACACTGGCTGCTTCTGG + Intronic
1042642045 8:70946991-70947013 ACCTGCACACTGGCCCCTGGTGG - Intergenic
1046114112 8:109765007-109765029 CCATCACCACTGGCCCATGGTGG + Intergenic
1049466543 8:142753525-142753547 CCCTACACACTGGCAGCTGCAGG - Intergenic
1060768403 9:126312245-126312267 CCAGCCACACTGGCCCTTGAAGG - Intergenic
1060826414 9:126690535-126690557 CCCTCCACACTGCCCTCTTGTGG + Intronic
1186068970 X:5796901-5796923 CTTTCCACAGTGGCTGCTGGTGG - Intergenic
1189143212 X:38628165-38628187 CCCTCCACAATGCCCGCTGTGGG + Intronic
1191762899 X:64663740-64663762 CCATCCACACCCACCACTGGTGG + Intergenic
1192874245 X:75211315-75211337 CCAGCCACTCCGGCCTCTGGGGG - Intergenic
1194838226 X:98708475-98708497 TCACCCACCCTGGCCTCTGGTGG + Intergenic
1199034338 X:143032935-143032957 CCAGCCACTCTGGCCTCTAGGGG - Intronic
1200214008 X:154359452-154359474 CCAGCCACACGGGCTCCTGGGGG + Intronic
1201525826 Y:14933078-14933100 CTTTCCACAGTGGCTGCTGGTGG + Intergenic