ID: 1023032784

View in Genome Browser
Species Human (GRCh38)
Location 7:36105328-36105350
Sequence TCTTAACCCCCAAAGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023032784_1023032786 19 Left 1023032784 7:36105328-36105350 CCAGGACACTTTGGGGGTTAAGA No data
Right 1023032786 7:36105370-36105392 CTGGAGCAACAGAAATAATCTGG No data
1023032784_1023032785 0 Left 1023032784 7:36105328-36105350 CCAGGACACTTTGGGGGTTAAGA No data
Right 1023032785 7:36105351-36105373 GTAGACACTATTAATATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023032784 Original CRISPR TCTTAACCCCCAAAGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr