ID: 1023032786

View in Genome Browser
Species Human (GRCh38)
Location 7:36105370-36105392
Sequence CTGGAGCAACAGAAATAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023032783_1023032786 24 Left 1023032783 7:36105323-36105345 CCAAACCAGGACACTTTGGGGGT No data
Right 1023032786 7:36105370-36105392 CTGGAGCAACAGAAATAATCTGG No data
1023032784_1023032786 19 Left 1023032784 7:36105328-36105350 CCAGGACACTTTGGGGGTTAAGA No data
Right 1023032786 7:36105370-36105392 CTGGAGCAACAGAAATAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023032786 Original CRISPR CTGGAGCAACAGAAATAATC TGG Intergenic
No off target data available for this crispr