ID: 1023034480

View in Genome Browser
Species Human (GRCh38)
Location 7:36118636-36118658
Sequence GTGATCTTTAGGGGGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023034480_1023034495 30 Left 1023034480 7:36118636-36118658 CCCAGGGCCCCCCTAAAGATCAC No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034480_1023034489 3 Left 1023034480 7:36118636-36118658 CCCAGGGCCCCCCTAAAGATCAC No data
Right 1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG No data
1023034480_1023034488 -8 Left 1023034480 7:36118636-36118658 CCCAGGGCCCCCCTAAAGATCAC No data
Right 1023034488 7:36118651-36118673 AAGATCACTGTGGAGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023034480 Original CRISPR GTGATCTTTAGGGGGGCCCT GGG (reversed) Intergenic