ID: 1023034481

View in Genome Browser
Species Human (GRCh38)
Location 7:36118637-36118659
Sequence AGTGATCTTTAGGGGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023034481_1023034488 -9 Left 1023034481 7:36118637-36118659 CCAGGGCCCCCCTAAAGATCACT No data
Right 1023034488 7:36118651-36118673 AAGATCACTGTGGAGCCTCCTGG No data
1023034481_1023034495 29 Left 1023034481 7:36118637-36118659 CCAGGGCCCCCCTAAAGATCACT No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034481_1023034489 2 Left 1023034481 7:36118637-36118659 CCAGGGCCCCCCTAAAGATCACT No data
Right 1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023034481 Original CRISPR AGTGATCTTTAGGGGGGCCC TGG (reversed) Intergenic