ID: 1023034483

View in Genome Browser
Species Human (GRCh38)
Location 7:36118643-36118665
Sequence CTCCACAGTGATCTTTAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023034483_1023034496 28 Left 1023034483 7:36118643-36118665 CCCCCCTAAAGATCACTGTGGAG No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data
1023034483_1023034489 -4 Left 1023034483 7:36118643-36118665 CCCCCCTAAAGATCACTGTGGAG No data
Right 1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG No data
1023034483_1023034495 23 Left 1023034483 7:36118643-36118665 CCCCCCTAAAGATCACTGTGGAG No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023034483 Original CRISPR CTCCACAGTGATCTTTAGGG GGG (reversed) Intergenic