ID: 1023034487

View in Genome Browser
Species Human (GRCh38)
Location 7:36118647-36118669
Sequence GAGGCTCCACAGTGATCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023034487_1023034489 -8 Left 1023034487 7:36118647-36118669 CCTAAAGATCACTGTGGAGCCTC No data
Right 1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG No data
1023034487_1023034496 24 Left 1023034487 7:36118647-36118669 CCTAAAGATCACTGTGGAGCCTC No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data
1023034487_1023034495 19 Left 1023034487 7:36118647-36118669 CCTAAAGATCACTGTGGAGCCTC No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023034487 Original CRISPR GAGGCTCCACAGTGATCTTT AGG (reversed) Intergenic
No off target data available for this crispr