ID: 1023034488

View in Genome Browser
Species Human (GRCh38)
Location 7:36118651-36118673
Sequence AAGATCACTGTGGAGCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023034480_1023034488 -8 Left 1023034480 7:36118636-36118658 CCCAGGGCCCCCCTAAAGATCAC No data
Right 1023034488 7:36118651-36118673 AAGATCACTGTGGAGCCTCCTGG No data
1023034481_1023034488 -9 Left 1023034481 7:36118637-36118659 CCAGGGCCCCCCTAAAGATCACT No data
Right 1023034488 7:36118651-36118673 AAGATCACTGTGGAGCCTCCTGG No data
1023034472_1023034488 28 Left 1023034472 7:36118600-36118622 CCATGGGCAACGGAACAGGCTGA No data
Right 1023034488 7:36118651-36118673 AAGATCACTGTGGAGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023034488 Original CRISPR AAGATCACTGTGGAGCCTCC TGG Intergenic
No off target data available for this crispr