ID: 1023034489

View in Genome Browser
Species Human (GRCh38)
Location 7:36118662-36118684
Sequence GGAGCCTCCTGGTACCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023034484_1023034489 -5 Left 1023034484 7:36118644-36118666 CCCCCTAAAGATCACTGTGGAGC No data
Right 1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG No data
1023034480_1023034489 3 Left 1023034480 7:36118636-36118658 CCCAGGGCCCCCCTAAAGATCAC No data
Right 1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG No data
1023034487_1023034489 -8 Left 1023034487 7:36118647-36118669 CCTAAAGATCACTGTGGAGCCTC No data
Right 1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG No data
1023034486_1023034489 -7 Left 1023034486 7:36118646-36118668 CCCTAAAGATCACTGTGGAGCCT No data
Right 1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG No data
1023034485_1023034489 -6 Left 1023034485 7:36118645-36118667 CCCCTAAAGATCACTGTGGAGCC No data
Right 1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG No data
1023034481_1023034489 2 Left 1023034481 7:36118637-36118659 CCAGGGCCCCCCTAAAGATCACT No data
Right 1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG No data
1023034483_1023034489 -4 Left 1023034483 7:36118643-36118665 CCCCCCTAAAGATCACTGTGGAG No data
Right 1023034489 7:36118662-36118684 GGAGCCTCCTGGTACCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023034489 Original CRISPR GGAGCCTCCTGGTACCCACC TGG Intergenic
No off target data available for this crispr