ID: 1023034490

View in Genome Browser
Species Human (GRCh38)
Location 7:36118666-36118688
Sequence TATTCCAGGTGGGTACCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023034490_1023034495 0 Left 1023034490 7:36118666-36118688 CCTCCTGGTACCCACCTGGAATA No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034490_1023034496 5 Left 1023034490 7:36118666-36118688 CCTCCTGGTACCCACCTGGAATA No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023034490 Original CRISPR TATTCCAGGTGGGTACCAGG AGG (reversed) Intergenic