ID: 1023034494

View in Genome Browser
Species Human (GRCh38)
Location 7:36118680-36118702
Sequence TTGGCTCTCACAGTTATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023034494_1023034496 -9 Left 1023034494 7:36118680-36118702 CCTGGAATAACTGTGAGAGCCAA No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023034494 Original CRISPR TTGGCTCTCACAGTTATTCC AGG (reversed) Intergenic