ID: 1023034495

View in Genome Browser
Species Human (GRCh38)
Location 7:36118689-36118711
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023034491_1023034495 -3 Left 1023034491 7:36118669-36118691 CCTGGTACCCACCTGGAATAACT No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034487_1023034495 19 Left 1023034487 7:36118647-36118669 CCTAAAGATCACTGTGGAGCCTC No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034485_1023034495 21 Left 1023034485 7:36118645-36118667 CCCCTAAAGATCACTGTGGAGCC No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034492_1023034495 -10 Left 1023034492 7:36118676-36118698 CCCACCTGGAATAACTGTGAGAG No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034483_1023034495 23 Left 1023034483 7:36118643-36118665 CCCCCCTAAAGATCACTGTGGAG No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034481_1023034495 29 Left 1023034481 7:36118637-36118659 CCAGGGCCCCCCTAAAGATCACT No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034484_1023034495 22 Left 1023034484 7:36118644-36118666 CCCCCTAAAGATCACTGTGGAGC No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034486_1023034495 20 Left 1023034486 7:36118646-36118668 CCCTAAAGATCACTGTGGAGCCT No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034490_1023034495 0 Left 1023034490 7:36118666-36118688 CCTCCTGGTACCCACCTGGAATA No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data
1023034480_1023034495 30 Left 1023034480 7:36118636-36118658 CCCAGGGCCCCCCTAAAGATCAC No data
Right 1023034495 7:36118689-36118711 ACTGTGAGAGCCAACATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023034495 Original CRISPR ACTGTGAGAGCCAACATCTG TGG Intergenic