ID: 1023034496

View in Genome Browser
Species Human (GRCh38)
Location 7:36118694-36118716
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023034493_1023034496 -6 Left 1023034493 7:36118677-36118699 CCACCTGGAATAACTGTGAGAGC No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data
1023034490_1023034496 5 Left 1023034490 7:36118666-36118688 CCTCCTGGTACCCACCTGGAATA No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data
1023034492_1023034496 -5 Left 1023034492 7:36118676-36118698 CCCACCTGGAATAACTGTGAGAG No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data
1023034494_1023034496 -9 Left 1023034494 7:36118680-36118702 CCTGGAATAACTGTGAGAGCCAA No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data
1023034491_1023034496 2 Left 1023034491 7:36118669-36118691 CCTGGTACCCACCTGGAATAACT No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data
1023034486_1023034496 25 Left 1023034486 7:36118646-36118668 CCCTAAAGATCACTGTGGAGCCT No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data
1023034484_1023034496 27 Left 1023034484 7:36118644-36118666 CCCCCTAAAGATCACTGTGGAGC No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data
1023034485_1023034496 26 Left 1023034485 7:36118645-36118667 CCCCTAAAGATCACTGTGGAGCC No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data
1023034483_1023034496 28 Left 1023034483 7:36118643-36118665 CCCCCCTAAAGATCACTGTGGAG No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data
1023034487_1023034496 24 Left 1023034487 7:36118647-36118669 CCTAAAGATCACTGTGGAGCCTC No data
Right 1023034496 7:36118694-36118716 GAGAGCCAACATCTGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023034496 Original CRISPR GAGAGCCAACATCTGTGGAG TGG Intergenic
No off target data available for this crispr