ID: 1023035761

View in Genome Browser
Species Human (GRCh38)
Location 7:36130231-36130253
Sequence GAGCCACTGGGACCCCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023035751_1023035761 29 Left 1023035751 7:36130179-36130201 CCCACAAAAACAGAGAGTATAAA No data
Right 1023035761 7:36130231-36130253 GAGCCACTGGGACCCCTGACAGG No data
1023035752_1023035761 28 Left 1023035752 7:36130180-36130202 CCACAAAAACAGAGAGTATAAAT No data
Right 1023035761 7:36130231-36130253 GAGCCACTGGGACCCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023035761 Original CRISPR GAGCCACTGGGACCCCTGAC AGG Intergenic
No off target data available for this crispr