ID: 1023037562

View in Genome Browser
Species Human (GRCh38)
Location 7:36146941-36146963
Sequence CCTTATAGCCAGAGAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023037562_1023037568 11 Left 1023037562 7:36146941-36146963 CCAGCCACTCTCTGGCTATAAGG 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1023037568 7:36146975-36146997 ACTGAATTGATGGTGTCCATAGG 0: 1
1: 0
2: 0
3: 9
4: 121
1023037562_1023037571 27 Left 1023037562 7:36146941-36146963 CCAGCCACTCTCTGGCTATAAGG 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1023037571 7:36146991-36147013 CCATAGGTCATACCTGAAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 121
1023037562_1023037566 1 Left 1023037562 7:36146941-36146963 CCAGCCACTCTCTGGCTATAAGG 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1023037566 7:36146965-36146987 CCCTGAGCAGACTGAATTGATGG 0: 1
1: 0
2: 0
3: 14
4: 169
1023037562_1023037569 26 Left 1023037562 7:36146941-36146963 CCAGCCACTCTCTGGCTATAAGG 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1023037569 7:36146990-36147012 TCCATAGGTCATACCTGAAAAGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023037562 Original CRISPR CCTTATAGCCAGAGAGTGGC TGG (reversed) Intergenic
901779997 1:11587626-11587648 GCTTATAGCCAGATGGTGGCTGG - Intergenic
902515627 1:16988000-16988022 CCACACAGCCGGAGAGTGGCAGG + Intronic
903501677 1:23803733-23803755 TCTCATAGCCTGGGAGTGGCAGG + Intronic
904474473 1:30756088-30756110 CCATACAGCCAGTTAGTGGCAGG + Intronic
905785111 1:40749255-40749277 CCATAGAGCCAGTAAGTGGCAGG - Intronic
906829194 1:49013766-49013788 CCTCATAGCTGGAAAGTGGCAGG - Intronic
907304613 1:53506768-53506790 CCTCATAGCCTGTGAGTGGTTGG + Exonic
908814674 1:68019462-68019484 CTTAAAAGCCAGAGAGTGACAGG - Intergenic
910934970 1:92480258-92480280 ACTTCCAGGCAGAGAGTGGCTGG + Intronic
911002734 1:93182211-93182233 CCTTATGGAAAGAAAGTGGCAGG - Intronic
912521865 1:110251059-110251081 GCTTCTACCCAGAGGGTGGCAGG + Intronic
912550955 1:110484988-110485010 CCGTGTGGGCAGAGAGTGGCTGG - Intergenic
915628892 1:157137080-157137102 CCTTCTGGCCAGTGAGTGGAAGG + Intronic
915932289 1:160068227-160068249 CATTAGAGCCACAGAGGGGCTGG + Intronic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
917628937 1:176874158-176874180 CCTCTAAGCCAGAGAGAGGCAGG - Intronic
918293032 1:183127754-183127776 CCTGAAAGCTGGAGAGTGGCTGG + Intronic
918308745 1:183270441-183270463 CCTTTCCTCCAGAGAGTGGCAGG - Intronic
918931639 1:190862538-190862560 CTTAAAAGACAGAGAGTGGCAGG - Intergenic
919522258 1:198602619-198602641 CCTTATAGCTAGGGAGTGCCAGG - Intergenic
923641853 1:235771051-235771073 CATTATTGCCAGATAATGGCAGG - Intronic
1064718790 10:18206563-18206585 TCTGAAAGCCAGAGAGTGGCTGG - Intronic
1066098316 10:32094248-32094270 CTTTAAAGCCAGAGAGTGGTGGG + Intergenic
1067177696 10:43961806-43961828 CCTTCCAGCCTGCGAGTGGCTGG + Intergenic
1075270628 10:121046646-121046668 CTTCATAGCCAGAAAGTGGCAGG - Intergenic
1075904339 10:126067391-126067413 CCTTATAACAAGCAAGTGGCCGG + Intronic
1079753979 11:24233099-24233121 CTTAAAAGCCATAGAGTGGCAGG - Intergenic
1080462953 11:32471669-32471691 TCTTATAACCACAGAATGGCAGG + Intergenic
1083946399 11:65925371-65925393 CCTTGTATCCGGAGAGTGACAGG + Intergenic
1084096371 11:66914169-66914191 CCTTATGGAGAGAGAGGGGCAGG - Intronic
1084456542 11:69271043-69271065 CATGATATCCAGAGAGTGGCAGG + Intergenic
1085412264 11:76298263-76298285 CCTTGCAGCCTGAGAGAGGCAGG + Intergenic
1089919640 11:122196381-122196403 CACTATAGCCAAAGAGTGTCAGG + Intergenic
1093246174 12:16739889-16739911 CCTGGTAGCCAGAGAGCGGTGGG - Intergenic
1096194325 12:49639955-49639977 ACTTTTAGCCACAGAGTGGCTGG + Exonic
1101761742 12:107664395-107664417 CCTTTTAACCAGAGAGAGACAGG + Intergenic
1101837778 12:108307173-108307195 CATTGTAGCCAAAGGGTGGCTGG + Intronic
1103492235 12:121330886-121330908 CCTGACAGCCACTGAGTGGCAGG + Intronic
1106362017 13:29039394-29039416 CCCTATGGCCAGAGGGTGCCCGG - Intronic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1116430824 14:44843595-44843617 TCTTATAGCCAAAAAGTGACTGG - Intergenic
1117316561 14:54576833-54576855 CCCTTTAGGCAGACAGTGGCTGG - Intronic
1119669679 14:76508928-76508950 CCATGCAGCCAGTGAGTGGCAGG - Intergenic
1120410169 14:84144386-84144408 GCCTATAGCCATAGAGTGCCTGG - Intergenic
1120627241 14:86843462-86843484 ACTTATAGCCAGGGAGTAGCAGG - Intergenic
1124212346 15:27774275-27774297 CCTCACTGCCAGAGAGAGGCGGG - Intronic
1127353055 15:58171654-58171676 CATTGTAGCCACTGAGTGGCAGG + Intronic
1127973818 15:63982750-63982772 GCCTATAGCCAGGAAGTGGCAGG - Intronic
1131933460 15:97473647-97473669 CCTTCCAGCCATTGAGTGGCAGG + Intergenic
1132615564 16:839743-839765 CCTTACTGCCACCGAGTGGCCGG + Intergenic
1133317015 16:4891179-4891201 CCTCATGACCAGACAGTGGCAGG - Intronic
1133324500 16:4935105-4935127 CCAGATATACAGAGAGTGGCAGG + Intronic
1133476851 16:6131838-6131860 ACAGAGAGCCAGAGAGTGGCAGG - Intronic
1133506575 16:6418234-6418256 CATTTTAGCCAGTGAGTGGCCGG + Intronic
1134025994 16:10954374-10954396 CCTTATAGGCAGAGAGGGCAGGG - Intronic
1134283382 16:12838149-12838171 CCATATTCCCATAGAGTGGCTGG + Intergenic
1136147981 16:28327050-28327072 CCACTTAGCCACAGAGTGGCGGG + Intergenic
1136223177 16:28841903-28841925 TCTTAAAACTAGAGAGTGGCCGG - Intergenic
1138140591 16:54564989-54565011 CCAAAGAGACAGAGAGTGGCAGG + Intergenic
1139287609 16:65829605-65829627 CTGTAAAGCCAGAGAGTGTCAGG - Intergenic
1140137832 16:72223511-72223533 CCTTATGACCAGTCAGTGGCTGG + Intergenic
1143624455 17:8101564-8101586 CCTTATATCCTGGGAATGGCAGG - Intronic
1145981150 17:29012439-29012461 TCTTATAGCCCCAGAGTGGCAGG + Intronic
1146955149 17:36932987-36933009 CCGTATAGCAAGAGGGTGGTGGG - Intergenic
1149612476 17:57967663-57967685 CCTGATAGCCACAGAGTCTCTGG + Intergenic
1151326958 17:73385517-73385539 TCACATAGCCAGTGAGTGGCAGG - Intronic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155318556 18:24595853-24595875 CTTTATTACCCGAGAGTGGCGGG - Intergenic
1158252703 18:55507343-55507365 ACTTATAGGCAGGGAGTGTCTGG + Intronic
1159397295 18:67877018-67877040 GCTTAGAGTCAGAAAGTGGCAGG - Intergenic
1159911811 18:74152646-74152668 CCTCATTGCCAGCCAGTGGCCGG + Intronic
1160452628 18:78975946-78975968 CCTGATTGCCCCAGAGTGGCAGG + Intergenic
1167715512 19:51140602-51140624 CCTTATGGGGAGAGAGTGGCTGG + Intergenic
1168257030 19:55172845-55172867 CCTCACAGCCAGCGTGTGGCAGG + Exonic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926859664 2:17295549-17295571 GGTTGTAGCCAGATAGTGGCTGG - Intergenic
927667254 2:25041602-25041624 GCACCTAGCCAGAGAGTGGCTGG + Intergenic
933164929 2:79065420-79065442 ACTGAGATCCAGAGAGTGGCTGG - Intergenic
933634236 2:84689802-84689824 TCTTCTAGTCAGTGAGTGGCAGG + Intronic
934921766 2:98349536-98349558 CCTTAGTGCCAGAGAATGGATGG + Intronic
935128501 2:100244084-100244106 AGTTACAGTCAGAGAGTGGCTGG + Intergenic
935128607 2:100244805-100244827 AGTTATAGTCAGAGGGTGGCTGG + Intergenic
935234342 2:101125779-101125801 CCTTAATGCCAGAGTGAGGCAGG + Intronic
938366297 2:130737229-130737251 CTTTAAAGCCAAAGAGCGGCCGG - Intergenic
939522916 2:143255049-143255071 TCTTAGAGCCAGACAGTGACTGG + Intronic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
941925583 2:170891200-170891222 CCTGATACCCAGAGAAAGGCAGG + Intergenic
946190682 2:218006263-218006285 CCTTAGAGCCTGAGCCTGGCAGG + Intergenic
948337480 2:237221751-237221773 ACACACAGCCAGAGAGTGGCTGG + Intergenic
1170205954 20:13798861-13798883 CCTTATACTCAGAGAGTGCTAGG + Intronic
1172774023 20:37396972-37396994 CCGAAGAGACAGAGAGTGGCGGG - Intronic
1175928585 20:62482644-62482666 TCTTAGAGCCAGCGGGTGGCTGG + Intergenic
1177219700 21:18175812-18175834 TTTAAGAGCCAGAGAGTGGCTGG + Intronic
1178089554 21:29148341-29148363 CCTTAGAGCCAGAGAGTACCTGG + Intronic
1180061658 21:45388437-45388459 CCTTAGAGCCAGAGAATGCAGGG - Intergenic
949327212 3:2880202-2880224 ATTTATAGACAGAGAGAGGCTGG + Intronic
953372198 3:42398093-42398115 CCTCATAGTTACAGAGTGGCAGG + Intronic
956444359 3:69311330-69311352 ACTTCTAGCAAGAGAGTTGCTGG - Exonic
957076978 3:75609891-75609913 CCTTAGAGCCAGGGAGGGGGAGG + Intergenic
960619015 3:119621466-119621488 CATGATGGCCTGAGAGTGGCTGG - Intronic
964604608 3:158546834-158546856 CCTCATAACTAGAGAGTGCCAGG - Intergenic
966257084 3:177929384-177929406 CCTTCTGGCCAGTGAGTGGATGG + Intergenic
969437625 4:7197842-7197864 TCCCAGAGCCAGAGAGTGGCAGG - Intronic
977058955 4:92232694-92232716 CCCTGGAGCCAGAGAGTGGTTGG - Intergenic
980401154 4:132287785-132287807 CCTTGTAGCAAGTGAGTAGCTGG + Intergenic
980425147 4:132618437-132618459 ACTTTTAGCCATGGAGTGGCTGG + Intergenic
982223244 4:153142367-153142389 CCTGAGAGACAAAGAGTGGCAGG + Intergenic
982364500 4:154560277-154560299 CCTTCAAGCCAGAGAGCTGCTGG + Intergenic
985654206 5:1121612-1121634 GCTTACAGCCAGTGAGTGGCAGG + Intergenic
986693081 5:10330184-10330206 CCTTATTGCCAGAATGTGACAGG - Intergenic
989195491 5:38712494-38712516 CATTAAAACCACAGAGTGGCTGG - Intergenic
996496292 5:124161100-124161122 CCTTCTCACCAGAAAGTGGCTGG + Intergenic
997408109 5:133668641-133668663 GCTAGTAGCCAGAGATTGGCTGG + Intergenic
998935969 5:147231798-147231820 CCTTATATCCAGGGAGAGGGAGG + Intergenic
999528210 5:152431596-152431618 CCTTAGAGCCAGAGACTGTGGGG + Intronic
999789180 5:154922529-154922551 TGTAATAGCCAGAGAGTGGTGGG - Intronic
1003237612 6:4310803-4310825 CCTTATAGGCAGAGAGAGAATGG + Intergenic
1007718931 6:43873949-43873971 GCACACAGCCAGAGAGTGGCAGG - Intergenic
1008465489 6:51825612-51825634 CATTATAGTTAGATAGTGGCTGG - Intronic
1017034283 6:150253012-150253034 CTGTTTAGCAAGAGAGTGGCAGG + Intergenic
1017563776 6:155662497-155662519 CTGTATAGCCGGGGAGTGGCAGG + Intergenic
1017606630 6:156141905-156141927 TCTAACAGCCAAAGAGTGGCAGG - Intergenic
1023037562 7:36146941-36146963 CCTTATAGCCAGAGAGTGGCTGG - Intergenic
1023882741 7:44329705-44329727 CCTGGTAGCCAGAGAGTGCCAGG - Intronic
1023908533 7:44538504-44538526 ACTTAAAGCAAGAGTGTGGCAGG + Intronic
1024631380 7:51250229-51250251 CCTTGCAGCCAGAAAGTGACTGG + Intronic
1032863335 7:135902387-135902409 CCTTTTACCCAGAAAGAGGCAGG - Intergenic
1037959578 8:23085838-23085860 CCTTAGAGACAGAGAGGGCCCGG + Intronic
1044323683 8:90835409-90835431 CCTCATAGACAGATAGTGGAGGG - Intronic
1047957048 8:129984184-129984206 CCCTGCAGCCAGAGAGAGGCAGG - Intronic
1048440454 8:134455717-134455739 CCTTGTAGCAACAGGGTGGCTGG - Intergenic
1048510435 8:135056994-135057016 CCTTGTAGTGGGAGAGTGGCAGG + Intergenic
1048529351 8:135233617-135233639 CCTGACAGCCAGAGCGGGGCAGG - Intergenic
1048854145 8:138672494-138672516 CCTTCTAGCCTAAGAGAGGCAGG - Intronic
1050254290 9:3777994-3778016 TAATATAGCTAGAGAGTGGCAGG + Intergenic
1052809478 9:33044496-33044518 CCTTACAGCCAGACCGCGGCGGG - Exonic
1055602123 9:77930877-77930899 CCGCACAGCAAGAGAGTGGCAGG + Intronic
1055683998 9:78750794-78750816 CATTAAAGGCACAGAGTGGCTGG - Intergenic
1056275446 9:84990463-84990485 CCTTAGAGCAAAAGAGTGCCTGG - Intronic
1057838978 9:98469756-98469778 CCTAAGAGCCAGAGAGGGGAAGG - Intronic
1058959271 9:109977767-109977789 GCTGATACCCAGAGAGAGGCAGG - Intronic
1059466206 9:114470387-114470409 CTGTATGGCCAGAGCGTGGCAGG + Intronic
1059466725 9:114473454-114473476 TCATACAGCTAGAGAGTGGCTGG - Intronic
1061196564 9:129110194-129110216 CCTTAGACCCAGAGACAGGCCGG - Intronic
1061428027 9:130513067-130513089 CCTTATAGCCAGGGGGTAGGAGG - Intergenic
1061780216 9:132991452-132991474 TGTTATAGCCAGAAAGAGGCCGG - Exonic
1186895739 X:14002847-14002869 CCAAATAGCCAGTGAGTGGTAGG + Intergenic
1189965377 X:46367089-46367111 CTTTATAGACAGAGAAGGGCTGG - Intergenic
1194919970 X:99752928-99752950 CCTTAGGGCCTGAGAGTGACGGG - Intergenic
1195956325 X:110334880-110334902 CCTTATAACCTGAGAGTGTCTGG + Intronic