ID: 1023038836

View in Genome Browser
Species Human (GRCh38)
Location 7:36154808-36154830
Sequence GTGGACTTCCGCCGTGAGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023038829_1023038836 26 Left 1023038829 7:36154759-36154781 CCAGCTCATGAGCGTGCGAGGCC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1023038836 7:36154808-36154830 GTGGACTTCCGCCGTGAGCATGG 0: 1
1: 0
2: 0
3: 1
4: 42
1023038828_1023038836 27 Left 1023038828 7:36154758-36154780 CCCAGCTCATGAGCGTGCGAGGC 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1023038836 7:36154808-36154830 GTGGACTTCCGCCGTGAGCATGG 0: 1
1: 0
2: 0
3: 1
4: 42
1023038832_1023038836 5 Left 1023038832 7:36154780-36154802 CCTCTCGGAGAAAATGGCCCTCA 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1023038836 7:36154808-36154830 GTGGACTTCCGCCGTGAGCATGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023038836 Original CRISPR GTGGACTTCCGCCGTGAGCA TGG Exonic
902301745 1:15507002-15507024 GTGAACTTCTGCCGTGAGTCCGG - Exonic
903011751 1:20336231-20336253 AAGGACTTCCGCAGGGAGCAAGG - Intronic
910613688 1:89172862-89172884 CTGGAGTTCTACCGTGAGCAAGG + Intronic
918447048 1:184626653-184626675 CTGCACTGCCGCAGTGAGCAGGG - Exonic
1063389772 10:5641676-5641698 GTGGGCTTCCGCGGAGAGCTGGG - Intronic
1067684815 10:48459783-48459805 GTGGACTTCATCCGGGAGCGCGG - Exonic
1069079978 10:64078069-64078091 GTGGACTTGCCCCGGGGGCAAGG + Intergenic
1076599278 10:131646608-131646630 GTGGAATTCCGCCCTGCCCAGGG - Intergenic
1076844855 10:133065066-133065088 GTGGCATTCCGCTGTGTGCAGGG + Intergenic
1077613561 11:3659841-3659863 CTGGGCTTCCGCGATGAGCATGG + Exonic
1083359457 11:62096010-62096032 GGGGACTCCCGCCTTGAGCTGGG - Intergenic
1083359993 11:62100008-62100030 GGGGACTCCCGCCTTGAGCTGGG + Intergenic
1104392115 12:128400127-128400149 GTGGACTTCCTCAGTGCGCGAGG - Intronic
1127334043 15:57966508-57966530 GTAGAGTTCTGCCTTGAGCAGGG - Intronic
1130460238 15:84154708-84154730 GTGTGCTGCAGCCGTGAGCATGG + Intergenic
1131706034 15:94997471-94997493 GTTGAGATCTGCCGTGAGCATGG + Intergenic
1132639466 16:971065-971087 GGGGCCTTCGGCCGTGGGCAGGG - Intronic
1140191444 16:72820504-72820526 CTGGACTGCCACCGTGAGCCCGG + Intronic
1144753062 17:17663329-17663351 GTGGACTTCCTGTGTGTGCAAGG - Intergenic
1160617858 18:80147573-80147595 CTGGACGTCCGCCCTGGGCAGGG + Intergenic
1164467285 19:28498173-28498195 GTGAAGTGCCGCAGTGAGCATGG - Intergenic
1165745460 19:38227957-38227979 GTGTGCTACAGCCGTGAGCAGGG - Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
938133819 2:128737577-128737599 GAGGGTTTCCGCCGGGAGCAGGG + Intergenic
1169786466 20:9364476-9364498 GTGGACTTCCTCCTGGAGGAGGG - Intronic
1180224782 21:46385944-46385966 GTTGACGTCGGCCTTGAGCATGG - Exonic
1181637838 22:24182450-24182472 CTGGCCTTCTGCCCTGAGCACGG + Intronic
1182064443 22:27420609-27420631 GTGGGCTTCCCCAGTGGGCATGG - Intergenic
1183700584 22:39448792-39448814 GGGGACTTGCTCCGTGTGCACGG + Intergenic
1184986201 22:48137075-48137097 ATGGACTTCCCCCGTGGCCAGGG - Intergenic
1185168738 22:49278589-49278611 GTGGACATCTGCTGTGTGCAGGG + Intergenic
964238891 3:154568064-154568086 GTGGACTCCTGACGTGAGCTGGG - Intergenic
968548036 4:1208429-1208451 GTAGACTTCCGCCCCGGGCACGG - Intronic
1007626910 6:43251841-43251863 GTGAACTTCGGCAGTGAGCATGG + Intronic
1011606086 6:89107232-89107254 GAGGACTTGCGCCGTGAGTTTGG - Exonic
1023038836 7:36154808-36154830 GTGGACTTCCGCCGTGAGCATGG + Exonic
1025022430 7:55490109-55490131 GTGGACTTACACTGTGAGCCAGG + Intronic
1025639613 7:63354157-63354179 GTGCAGTTCCGCCGTGCGGAGGG + Intergenic
1025643086 7:63393935-63393957 GTGCAGTTCCGCCGTGCGGAGGG - Intergenic
1033461640 7:141551670-141551692 GCTGACTCCCGCCGTGACCACGG - Intronic
1041249282 8:55918895-55918917 GTGGACTTCAGCAGCGAGAATGG + Intronic
1047759663 8:127944895-127944917 CTGGACCTCAGCCATGAGCACGG - Intergenic
1058910587 9:109516913-109516935 GGGGACTTGCGAGGTGAGCAGGG + Intergenic
1061407153 9:130398676-130398698 CTGGACTTCCGCCTGCAGCAGGG + Intronic