ID: 1023039297

View in Genome Browser
Species Human (GRCh38)
Location 7:36158302-36158324
Sequence CACCCATCCTCTCCCTCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023039295_1023039297 -6 Left 1023039295 7:36158285-36158307 CCTGCCTCTTGGTTAGACACCCA 0: 1
1: 0
2: 1
3: 12
4: 122
Right 1023039297 7:36158302-36158324 CACCCATCCTCTCCCTCATCAGG No data
1023039294_1023039297 1 Left 1023039294 7:36158278-36158300 CCTTTAACCTGCCTCTTGGTTAG 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1023039297 7:36158302-36158324 CACCCATCCTCTCCCTCATCAGG No data
1023039296_1023039297 -10 Left 1023039296 7:36158289-36158311 CCTCTTGGTTAGACACCCATCCT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1023039297 7:36158302-36158324 CACCCATCCTCTCCCTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023039297 Original CRISPR CACCCATCCTCTCCCTCATC AGG Intronic
No off target data available for this crispr