ID: 1023041707

View in Genome Browser
Species Human (GRCh38)
Location 7:36178471-36178493
Sequence AAGGGCTTAGAGACAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023041707_1023041718 30 Left 1023041707 7:36178471-36178493 CCTCCAGCTGTCTCTAAGCCCTT 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1023041718 7:36178524-36178546 ATTTCATATGGGCTTTAACTGGG 0: 1
1: 0
2: 1
3: 14
4: 143
1023041707_1023041717 29 Left 1023041707 7:36178471-36178493 CCTCCAGCTGTCTCTAAGCCCTT 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1023041717 7:36178523-36178545 GATTTCATATGGGCTTTAACTGG 0: 1
1: 0
2: 2
3: 6
4: 129
1023041707_1023041715 19 Left 1023041707 7:36178471-36178493 CCTCCAGCTGTCTCTAAGCCCTT 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1023041715 7:36178513-36178535 AATTCTTCCAGATTTCATATGGG 0: 1
1: 0
2: 3
3: 45
4: 905
1023041707_1023041710 -5 Left 1023041707 7:36178471-36178493 CCTCCAGCTGTCTCTAAGCCCTT 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1023041710 7:36178489-36178511 CCCTTGATTCTCCTGCCATTTGG 0: 1
1: 0
2: 0
3: 10
4: 177
1023041707_1023041714 18 Left 1023041707 7:36178471-36178493 CCTCCAGCTGTCTCTAAGCCCTT 0: 1
1: 0
2: 3
3: 12
4: 202
Right 1023041714 7:36178512-36178534 AAATTCTTCCAGATTTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023041707 Original CRISPR AAGGGCTTAGAGACAGCTGG AGG (reversed) Intronic
900183678 1:1323338-1323360 AGGGTCTCAGAAACAGCTGGAGG - Intronic
900511167 1:3061878-3061900 CAGGGCCCATAGACAGCTGGGGG - Intergenic
900798699 1:4724764-4724786 CTGGGCTTAGAGACAGCTGCAGG + Intronic
900873707 1:5326050-5326072 AAGAGCAAAGAGACAGCTGCAGG + Intergenic
903117202 1:21188159-21188181 CTTGGCTTAGAGACTGCTGGAGG - Intergenic
903391240 1:22964905-22964927 GAGGTCTTAGATACAGCTGCAGG + Intronic
903974202 1:27138517-27138539 ATGGGGGTAGAGGCAGCTGGTGG + Intronic
905224981 1:36473022-36473044 AAGGGCATAGAGAGAGAGGGGGG - Intronic
906611164 1:47204511-47204533 AAGGGGAGAGAAACAGCTGGAGG - Intergenic
907128234 1:52071615-52071637 TAGGGCTTAGAGAAAGCTTAAGG + Intronic
907612426 1:55885905-55885927 CAGGGTTTAGAGTCACCTGGAGG + Intergenic
907742772 1:57183289-57183311 AAAGGCTTAGATACTACTGGAGG + Intronic
907985197 1:59523812-59523834 AAGGGCAAAGAGACAGCTGATGG - Intronic
908811781 1:67988779-67988801 AAGGTCATAGATAGAGCTGGAGG - Intergenic
909300773 1:74010482-74010504 AATGCCTGAGAGACAGCTGGAGG - Intergenic
909316965 1:74233949-74233971 AAGTGCTTAGAGAAAGCTGGTGG + Intronic
913059426 1:115191302-115191324 AAGGACTTAGAGACTGCTGGAGG - Intergenic
918405300 1:184206400-184206422 AATGGCTGGGAGATAGCTGGTGG - Intergenic
920350160 1:205332629-205332651 TAGAGCTTAGAGACAGCAGCAGG + Intergenic
921361360 1:214333529-214333551 CAGGGCCCAGAGGCAGCTGGTGG - Intronic
923831030 1:237557440-237557462 AAAGGCTTAGAGACACAAGGAGG + Intronic
924253995 1:242163956-242163978 AATCACTTATAGACAGCTGGAGG - Intronic
1062977213 10:1693107-1693129 AAAGGCTTAGAAACACCTGAGGG - Intronic
1063546817 10:6989205-6989227 ATGGTCTTGGAGCCAGCTGGTGG - Intergenic
1063988988 10:11539123-11539145 AGGGGCTGAGAGAGAGCAGGAGG - Intronic
1064947450 10:20806652-20806674 AGGGGCTTAGAGGCTGGTGGGGG - Intronic
1065517300 10:26537119-26537141 AAGGTCTTAGAGAGAGCTGATGG - Intronic
1067708945 10:48633613-48633635 AAGGGCATAGAGTAAGCAGGTGG + Intronic
1068701044 10:60019937-60019959 AAGGTCTCACAGACAGCTTGTGG - Intergenic
1070823368 10:79375995-79376017 GAGGGCTAAGAGAAGGCTGGTGG + Intergenic
1072692798 10:97582904-97582926 AAGTGCAGAGAGACAGCAGGAGG + Intronic
1073072015 10:100800603-100800625 AAGGGACAAGAGACAGTTGGGGG - Intronic
1075594101 10:123715495-123715517 AAGGGATTTGAGACTGCTGAGGG + Intronic
1078068995 11:8096114-8096136 AAGGACTTTGAGACAACTTGAGG + Intronic
1079090226 11:17475875-17475897 AAGGTCTTGGAGAGAGATGGGGG + Intronic
1079119735 11:17673337-17673359 CAGGGCTCAGAGAGAGATGGAGG - Intergenic
1079385213 11:19972765-19972787 AGGGGCTTAGTGTCAGCTTGGGG - Intronic
1081575478 11:44316418-44316440 AGGGGCTTTGAGACCGCGGGCGG + Intergenic
1082317984 11:50753521-50753543 AAGCGCTTAGAGACCTATGGTGG - Intergenic
1082707124 11:56506076-56506098 AAGGGCATGAAGACAGATGGTGG - Intergenic
1084096180 11:66913004-66913026 ATGGGCTTTGAGCCAGCTTGGGG - Intronic
1084648158 11:70472877-70472899 AAGGGCTTTGAAACAGCTGCTGG - Intronic
1084869273 11:72085726-72085748 TAAGTCTTAGAGTCAGCTGGAGG + Intronic
1087745027 11:101934108-101934130 ATGTGCTTGAAGACAGCTGGAGG - Intronic
1088397337 11:109382973-109382995 CAGAGCTGAGAGACAGATGGAGG - Intergenic
1089499679 11:118924997-118925019 GAGGGCTTAGGGACAGCCAGGGG - Intronic
1091221112 11:133930654-133930676 AGGGCCTTAGGGAGAGCTGGAGG - Intronic
1092281824 12:7103241-7103263 AAGGGCAAAAAGAAAGCTGGAGG - Intronic
1093244072 12:16713718-16713740 AATGGCCAAGAGTCAGCTGGAGG - Intergenic
1094221283 12:27996242-27996264 AAGGGCTCAGAGTCTGTTGGGGG + Intergenic
1096135964 12:49201024-49201046 AAAGGCTTAGAGAACGCTGTGGG + Intronic
1096842143 12:54385908-54385930 GAGGGCTCAGGCACAGCTGGGGG + Intronic
1098540484 12:71650900-71650922 AAGGGATTAGAGATGGCAGGAGG - Intronic
1100616995 12:96238489-96238511 ACGGGCCTGGAGACAGCCGGGGG + Intronic
1102566947 12:113803155-113803177 CAGGGCTTAGAGCCTGCTGCCGG + Intergenic
1104334104 12:127876493-127876515 AGGGACATAGAGAGAGCTGGAGG - Intergenic
1105306749 13:19174275-19174297 AAGGGCTTAGTGACATTTGTGGG - Intronic
1105577632 13:21668959-21668981 ATGTGGTTGGAGACAGCTGGTGG + Intergenic
1109114144 13:58360007-58360029 AAGTGCTTATATACTGCTGGTGG + Intergenic
1115938740 14:38584942-38584964 AGGGGCATAGATAGAGCTGGAGG - Intergenic
1117066180 14:52015007-52015029 AAGGCCTTAGATACAGCTGAGGG + Intronic
1118292936 14:64542059-64542081 CTGGGCATCGAGACAGCTGGCGG + Exonic
1118333308 14:64831090-64831112 ATGGGCTCAGGGAAAGCTGGTGG + Intronic
1118659961 14:67997505-67997527 AAGGGGTTGGAGGCAGCTAGAGG - Intronic
1119824890 14:77649412-77649434 AAGGGCTTGTGGACAGCTGCTGG + Intergenic
1119918225 14:78422447-78422469 AAAGGTTTAGAATCAGCTGGTGG + Intronic
1119968795 14:78946455-78946477 AGGAGCTTAGAGTCTGCTGGGGG - Intronic
1120077965 14:80181741-80181763 AATGGGTTAGACACAGCTGAAGG + Intergenic
1120311800 14:82838192-82838214 AAGGGTATAGAGGCAGTTGGGGG - Intergenic
1123441723 15:20296396-20296418 AAGGAGTTAGAGACAGGTGTGGG + Intergenic
1124103164 15:26713894-26713916 CAGGGATCAGAGACGGCTGGTGG + Intronic
1125417699 15:39470540-39470562 AAGGGGAGAGAAACAGCTGGAGG - Intergenic
1126319249 15:47404515-47404537 AAGGTCTTAGAGAGAGGTGGTGG - Intronic
1129472525 15:75763466-75763488 GAGGACTTAGGCACAGCTGGGGG + Intergenic
1129685470 15:77684014-77684036 AAAGGCCTAGAGGCAGCTTGGGG - Intronic
1132231896 15:100190579-100190601 AAGGGCACAGGGACAGCAGGAGG + Intronic
1132247094 15:100306106-100306128 GAGGGATCAGAGACAGCTCGAGG - Intronic
1133028395 16:2998420-2998442 AAGGGCTGAGAGGCAGAAGGAGG - Intergenic
1134160136 16:11881187-11881209 AAAGACATAGAGGCAGCTGGTGG - Intronic
1134249922 16:12567140-12567162 CTGGGCTTGGATACAGCTGGGGG + Intronic
1135077715 16:19408693-19408715 AATGGCTTAGAGAAAGGAGGAGG - Intergenic
1136337359 16:29618981-29619003 AAGGCCTGAGGGACACCTGGGGG - Intergenic
1137816901 16:51406826-51406848 TAGGCCTGAGAGACAGATGGCGG + Intergenic
1141479790 16:84298874-84298896 AAGGTCTTAGAGATAGAAGGCGG - Intronic
1141595635 16:85095244-85095266 AAGGGCATACAGTCAGCTGCCGG - Intergenic
1143108484 17:4541060-4541082 CAGGGCTGGGAGGCAGCTGGAGG - Intronic
1144680155 17:17187794-17187816 AAAGTCTTAGGGACAGCTGCAGG + Exonic
1145877175 17:28328055-28328077 AAAGACTTAGAGAAAGCTGATGG - Exonic
1147331262 17:39700659-39700681 AAAGGCTTTGAGAAAGCTTGAGG - Intronic
1150208556 17:63428240-63428262 AAGGGCTTCGTCACAACTGGAGG + Intergenic
1151458752 17:74242223-74242245 AAGGGCTTGGAGGAGGCTGGAGG + Intronic
1151612321 17:75184165-75184187 GAGGGGTTGGAGACAGCTGGCGG - Intergenic
1153415966 18:4845984-4846006 ATGGGGTTAAAGAGAGCTGGGGG + Intergenic
1153709191 18:7780771-7780793 AAGGGCTTAGAGAGCAATGGGGG + Intronic
1153946281 18:10020685-10020707 AATGGCTTAGAGGCAGGAGGAGG + Intergenic
1161718565 19:5891200-5891222 AAGAGCTTAGAGACCCCCGGCGG + Intronic
1161901631 19:7123627-7123649 AAGGGTTTGGAGTCAGCTGGGGG + Intronic
1162900655 19:13793829-13793851 AAGGGCTCAGAGACCACTTGTGG + Intergenic
1163153869 19:15429646-15429668 GGGGGCTCAGGGACAGCTGGGGG + Intronic
1163157328 19:15446574-15446596 CAAGGCTTAGAGGTAGCTGGTGG - Intronic
1163587643 19:18172851-18172873 GAGGGCTCAGAGGCAGGTGGGGG - Exonic
1166536881 19:43580245-43580267 AAGGGAGGAGAGAGAGCTGGGGG + Intronic
1168129411 19:54308029-54308051 AAGGGCTCAGTGACTTCTGGGGG - Intronic
925639070 2:5970018-5970040 AGAGGCTTAGAGAGAGGTGGTGG + Intergenic
930094251 2:47554757-47554779 AGGAGCATAGAGAAAGCTGGGGG + Intronic
931268146 2:60678756-60678778 TAGGGCTTATAGCCAGGTGGCGG - Intergenic
931762045 2:65426675-65426697 AATGGCTCAGAGATGGCTGGGGG + Intronic
935638971 2:105272762-105272784 AAGGGCTTTGGCACAGCTGCTGG - Intronic
936389341 2:112057142-112057164 AAGGGCTTTTAGACTTCTGGCGG - Intronic
938800882 2:134762329-134762351 AGTGGCTTAGACACAGGTGGTGG - Intergenic
939037921 2:137155328-137155350 ATGGTCTAAGAGGCAGCTGGAGG + Intronic
941510536 2:166402736-166402758 AAGGGCTTACTGACTACTGGGGG - Intergenic
941719657 2:168799879-168799901 AAGGGCATAGAGACAGAGAGGGG - Intronic
943255003 2:185583591-185583613 AAGGGCTGTGAGTCAGCAGGTGG - Intergenic
943464519 2:188212363-188212385 GAGTGCTTAGAGAAAGCTGTAGG - Intergenic
945348867 2:208752380-208752402 AAGGGCTGAGAGACAGCACCTGG - Intronic
945569698 2:211450757-211450779 AAGGGTTTAGAGACTTATGGAGG - Intronic
946398443 2:219455540-219455562 AGGAGCTTAGGGCCAGCTGGAGG + Intronic
946935008 2:224710858-224710880 AAGGGGATAGAGACAGATGCAGG + Intergenic
947811042 2:233004163-233004185 AAGGTCCTTGAGAAAGCTGGAGG + Intronic
948074720 2:235156843-235156865 AGAGGCATAGAGACAGCTGATGG - Intergenic
948477391 2:238229008-238229030 AAGGGCATGGAGACAGAAGGTGG + Intronic
948800615 2:240431811-240431833 AGGGGCTTGGAGAGAGGTGGAGG + Intergenic
948935212 2:241159420-241159442 AAGGGCTAAGAGCCAGCAGGAGG - Intronic
1168876094 20:1173304-1173326 AAGGGCTTTGGGACACTTGGAGG + Intronic
1170184002 20:13566806-13566828 AAGTGCTTACACACTGCTGGTGG + Intronic
1173546630 20:43902969-43902991 AAGGGCCTGGATACAGCTGGAGG - Intergenic
1174528773 20:51194333-51194355 AAGAGCTCAGGGACCGCTGGGGG + Intergenic
1175390915 20:58626810-58626832 AAGGGCAAAGACACAGCAGGAGG - Intergenic
1177544661 21:22540863-22540885 GAATGCTTATAGACAGCTGGTGG + Intergenic
1178362538 21:31961104-31961126 CAGGGCTTAGGGAGAGCAGGAGG - Intronic
1179978533 21:44884605-44884627 GAAGGCATAGACACAGCTGGAGG + Intergenic
1181159175 22:20947071-20947093 AATGGCTGAGAGACTTCTGGTGG - Intronic
1181947911 22:26532625-26532647 AAGGGCATACAGCCAGATGGTGG + Intronic
1182003896 22:26943290-26943312 AAGGGCTCAGAGACAGGAAGTGG + Intergenic
1183523751 22:38311547-38311569 AAGGGCATGGAGACAGCTCTTGG - Intronic
1184948082 22:47818424-47818446 AAGAGCCTACAGAAAGCTGGCGG + Intergenic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
949353165 3:3146792-3146814 AAGAGCTCAAAGACAGCTTGTGG + Intronic
950104502 3:10379591-10379613 AGGGGATTAGAGTCTGCTGGAGG + Intronic
950846093 3:16017449-16017471 AAAGGCTTAGAGGCAGGTGCAGG + Intergenic
952302016 3:32111655-32111677 AGAGGCTGATAGACAGCTGGAGG + Intronic
952909809 3:38173875-38173897 AAGGGGTTAGGGACTGCTAGGGG + Intronic
956756053 3:72388026-72388048 AAGGGCTGAGGGAGAGCTGAAGG - Intronic
957966256 3:87324756-87324778 ATGGGCTCTGAGACAGCTGCAGG - Intergenic
958623828 3:96599689-96599711 AAGGGCATGGATAGAGCTGGAGG + Intergenic
960155021 3:114290848-114290870 TAAGGCTGTGAGACAGCTGGGGG + Intronic
960839339 3:121940533-121940555 AAGGGAGAAGAGAAAGCTGGAGG - Intronic
960993198 3:123324982-123325004 CAGTGCCAAGAGACAGCTGGAGG + Intronic
961045347 3:123704132-123704154 AAGGGGTCAGAGAAAGGTGGAGG + Intronic
961672726 3:128546764-128546786 ATGTGCCTATAGACAGCTGGTGG + Intergenic
961981424 3:131083371-131083393 CAGTGCTGAGAGACAGCTGTGGG + Intronic
968549619 4:1215423-1215445 AAGGGCCTGGAGCCAGCGGGAGG + Intronic
970320285 4:14868292-14868314 AAGGACTCAGAGAAAGCTGTGGG + Intergenic
973197938 4:47466866-47466888 AGGGGCTTAGTGATAGATGGTGG + Intergenic
976223209 4:82774825-82774847 AAGAGCTTTGAGACTGATGGAGG + Intronic
976559506 4:86485370-86485392 TAGGGCTTAGAGTCAACTGAGGG - Intronic
977292923 4:95182512-95182534 AAGGGAGGAGAGACAGATGGAGG + Intronic
983778090 4:171633489-171633511 AAAGGCTTATACACTGCTGGTGG - Intergenic
987110047 5:14677245-14677267 AGGGGCTTATGGACTGCTGGAGG - Intronic
987358528 5:17085693-17085715 AAGGGCTGAGGGATAGCTAGAGG + Intronic
991398917 5:66233874-66233896 AAGGGCTTAGAGACAAGTCTGGG + Intergenic
992427088 5:76669405-76669427 GTGGGCTTACAGACACCTGGTGG - Intronic
992621245 5:78595408-78595430 AAGGGCTTATAGATTTCTGGTGG - Intronic
993395424 5:87381249-87381271 AAGGTTTTATAGAAAGCTGGTGG + Intronic
993416615 5:87641187-87641209 AAGGTGTTAGAGAGAGATGGAGG - Intergenic
995560602 5:113377070-113377092 AAGGGCTGAGACACAGCAGAAGG + Intronic
995719586 5:115116574-115116596 AAGGGGCTACAGACTGCTGGAGG - Intergenic
998169417 5:139863862-139863884 AGGGGCATAGAGACCCCTGGGGG - Intronic
999044898 5:148456404-148456426 ATGGGCCTACAGACTGCTGGAGG - Intronic
999451980 5:151685474-151685496 AGGGGCTTAGAGATGGCTTGAGG + Intronic
999468486 5:151830139-151830161 AATGGCTTCCAGACAGCTGTTGG - Intronic
1003886457 6:10525528-10525550 AAGGGCATTGGGAAAGCTGGAGG + Intronic
1004791946 6:19036194-19036216 AAGGGCTTGGAAACAGCTAACGG + Intergenic
1006341418 6:33449134-33449156 GAGGGCTTAGAGTCAGGAGGAGG - Intronic
1006445775 6:34079006-34079028 AAAGGCCTAGTGAGAGCTGGAGG - Intronic
1009445148 6:63733581-63733603 AAGCACATAGATACAGCTGGAGG - Intronic
1010467108 6:76180888-76180910 AAGGACATAGATAGAGCTGGAGG - Intergenic
1010976591 6:82322045-82322067 AAGAGCTGAGAGATAGCTTGAGG + Intergenic
1011479015 6:87775897-87775919 AAGGGCTCAGAGATAAATGGAGG + Intergenic
1012889874 6:104885763-104885785 AAGGGCTCCGAGGCAGCAGGGGG - Intergenic
1013644370 6:112121566-112121588 ATGGGGTTGGAGATAGCTGGAGG + Intronic
1015456375 6:133431209-133431231 AAGGCCTTAGAGACTGTGGGAGG + Intronic
1018592923 6:165447238-165447260 AAGAGAATAGAGACAGCTGCGGG - Intronic
1019587520 7:1813425-1813447 AAGGGCTTGGGGACAGTGGGTGG + Intergenic
1019674912 7:2305138-2305160 CAGGCCTCAGAAACAGCTGGAGG + Intronic
1021901257 7:25288018-25288040 ATGGACTTATAGAGAGCTGGAGG + Intergenic
1023041707 7:36178471-36178493 AAGGGCTTAGAGACAGCTGGAGG - Intronic
1024660446 7:51487898-51487920 AAGAACATACAGACAGCTGGAGG - Intergenic
1028085281 7:86628854-86628876 AAGGTCTCAGAGACATCTGAGGG + Intergenic
1028580793 7:92408120-92408142 TAGGGCTTAGAGAACACTGGAGG - Intergenic
1029148641 7:98464726-98464748 CAGGGCCTGGAGACAGCTGTGGG + Intergenic
1029415916 7:100443165-100443187 AAGAGCCCAGGGACAGCTGGAGG + Intergenic
1029705127 7:102272083-102272105 AAGGGCTTAGACAGAGCTGGGGG + Intronic
1038015072 8:23507983-23508005 AAGTACTTAGAGTCAGCAGGGGG + Intergenic
1038847716 8:31245216-31245238 AAGCTATTAGGGACAGCTGGCGG - Intergenic
1041257448 8:55991339-55991361 CAGGGCTTTGAGGCAGCTAGAGG - Intronic
1045415994 8:101968134-101968156 TGGGGCTTAGAGAAACCTGGAGG - Intronic
1047604007 8:126456222-126456244 AGAGGCTGAGAGACAGTTGGAGG - Intergenic
1048549200 8:135417877-135417899 AAGGACCTAGAGACAGGAGGAGG + Intergenic
1049257600 8:141622293-141622315 AAGGGCTGGGAGGAAGCTGGAGG - Intergenic
1049492766 8:142913921-142913943 GAGGGTTGAGAGGCAGCTGGAGG - Intronic
1049800328 8:144514658-144514680 AAGGGTTTAGAGCCACCTGTGGG + Intronic
1052549349 9:29928316-29928338 GAGAGCATAGAGACAGCAGGTGG + Intergenic
1053110687 9:35457291-35457313 AAAGGCTTAGAGGCAGATGTAGG + Intergenic
1053150030 9:35737413-35737435 GAGGGCTTCCAGACAGCTGAAGG - Exonic
1055632989 9:78243082-78243104 AAGTGTTTAGAGACCACTGGAGG + Intronic
1057999407 9:99849902-99849924 AAGTGCTCAGAGACAGCAGGTGG + Intronic
1059805076 9:117790023-117790045 GAGGCCCTTGAGACAGCTGGCGG - Intergenic
1060328122 9:122637632-122637654 AAGGCCTTAAAGAAAGCTTGAGG - Intergenic
1187493770 X:19777085-19777107 AAAGGCTTAAAGACAACTGATGG - Intronic
1187731920 X:22264168-22264190 AAGGGCTTAGTTACAGCATGGGG - Intergenic
1189373689 X:40449618-40449640 CAGGGCTCAGAGAGTGCTGGAGG + Intergenic
1190787808 X:53669445-53669467 AAGGTCTTAAAGCCAGTTGGTGG - Intronic
1192366744 X:70480098-70480120 AAGCCCTTAGAGAAAGGTGGTGG + Intronic
1199197936 X:145054221-145054243 AAAGGCTTAAACACTGCTGGAGG + Intergenic
1199386215 X:147226202-147226224 AAGTGCTTAGACACAGAAGGGGG - Intergenic
1201899553 Y:19034869-19034891 AAGGGCTTACAGACAGCACCTGG + Intergenic