ID: 1023042788

View in Genome Browser
Species Human (GRCh38)
Location 7:36186723-36186745
Sequence ACGTGGGTGGAGGAGTACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023042788 Original CRISPR ACGTGGGTGGAGGAGTACAC AGG Intronic
901840443 1:11950752-11950774 ACGTAGGTGGAGGAGGGCAAGGG - Intronic
902980719 1:20120958-20120980 ACTTGGGTGGAGGAGCTGACGGG + Intergenic
904890919 1:33778918-33778940 ATGTGGGAGGAGGAGTCAACAGG - Intronic
907328641 1:53657313-53657335 ACTTGGGTGGTGGAATATACAGG - Intronic
907560170 1:55380839-55380861 AGGAGGGAGGAGGAGTTCACGGG - Intergenic
918134740 1:181661514-181661536 AGGTGGCTGGGGGAGAACACAGG + Intronic
920370657 1:205477441-205477463 ATGTGGGGTGAGGAGCACACTGG + Intergenic
1062904237 10:1169321-1169343 GCGGGGGTGGAGGTGTGCACGGG + Intergenic
1072189827 10:93070231-93070253 ATGGGGGTGGAGGAGAGCACTGG - Intergenic
1072499167 10:95994937-95994959 TTGTGGGTGGAGGATTACCCAGG - Intronic
1074286475 10:112102639-112102661 AGGTGGGTACAGGGGTACACAGG - Intergenic
1075806877 10:125195544-125195566 ACTTGGGTGGGGGAGGACAGAGG + Intergenic
1076076710 10:127539044-127539066 ACTGGGGTGGAGCAGAACACAGG - Intergenic
1077035996 11:494808-494830 GCGGGGGTGGGGGAGGACACGGG - Intronic
1078531444 11:12139563-12139585 ACGTGGGGTGAGGAGTCCACGGG + Intronic
1080822959 11:35824568-35824590 CCTCGGGTGGAGGAGTCCACTGG - Intergenic
1085819434 11:79776554-79776576 ATGTGGGTGGAGGTGTCCATTGG + Intergenic
1086426046 11:86683285-86683307 ACATGGTTGGAGGAGGAAACGGG - Intergenic
1086499326 11:87436214-87436236 ACGTGGATGTAGGAGTACAATGG + Intergenic
1089963663 11:122637713-122637735 ACGTGGGTCGATGGGTACTCTGG - Intergenic
1091799160 12:3313876-3313898 ACGGGGGTGGAGGAGCAGGCAGG - Intergenic
1093548148 12:20371113-20371135 ACGTGGGAGGAGGAGGAACCTGG + Intronic
1094639407 12:32259329-32259351 TTGTGGGTGGAGGATTACCCAGG - Intronic
1097467527 12:59946251-59946273 AACTGGGTGTAGGAGTACATAGG - Intergenic
1101760280 12:107652605-107652627 TCGGGGGTGGGGGACTACACTGG - Intronic
1104219458 12:126767640-126767662 GCGTGGCTGGCGGAGTAGACAGG + Intergenic
1106715837 13:32387149-32387171 GTGTGGGTGGAGGATTACCCAGG + Intronic
1107876390 13:44794512-44794534 ACATGGGTGGACAAGTACACAGG - Intergenic
1109727419 13:66361221-66361243 AAGTGAGTGGAGGAGTAAAGGGG - Intronic
1110330107 13:74261822-74261844 ACGTGTGTGTGGTAGTACACTGG + Intergenic
1112339418 13:98540602-98540624 AGTTAGGTGGAGGAGTAGACAGG - Intronic
1113933306 13:113980052-113980074 ACATGGGAGGAGGTGCACACAGG - Intronic
1115573995 14:34693435-34693457 ACCTCGGTGGAGGAATACACAGG + Intergenic
1124845967 15:33290323-33290345 ATGTGGGCAGAGGAGTAAACAGG - Intergenic
1125508193 15:40279475-40279497 ACATGGATGAAGAAGTACACAGG + Intronic
1126830797 15:52602696-52602718 ACTCGGGTGGAGTAGTACATGGG - Intronic
1127417018 15:58768203-58768225 ATGTGGGTGGAGGATTACCTAGG + Intergenic
1129468021 15:75734638-75734660 CTGTGGGTGGAGGATTACTCAGG + Intergenic
1130894043 15:88157067-88157089 AGGTGGGTGGAGGAGGGCAGTGG - Intronic
1130973305 15:88752732-88752754 CTGTGGGAGGAGGAGTTCACAGG - Intergenic
1131035443 15:89218925-89218947 AGGTGGGTGGAGGAGAGCCCTGG + Intronic
1132702818 16:1229280-1229302 ACGTGGCTGGAGACGTTCACCGG + Exonic
1132705508 16:1241588-1241610 ACGTGGCTGGAGACGTTCACCGG - Exonic
1134396067 16:13864606-13864628 ACTTGGGTGGACTAATACACAGG + Intergenic
1134608446 16:15589399-15589421 AGGTTGGTGAAGGAGGACACGGG - Intronic
1134776961 16:16861898-16861920 ACGGGGGAGGAGGAGAAAACAGG - Intergenic
1135480647 16:22818133-22818155 ATGTGGGTGGGGGAGAACCCAGG - Intronic
1138179359 16:54931501-54931523 ACGGGGGCGGAGGGGGACACGGG + Intronic
1140506876 16:75479116-75479138 ACGTGGGTGGAGGCCGACCCCGG - Exonic
1143149749 17:4800481-4800503 ACGTGGGGAGAGGAGCACATGGG - Intergenic
1147403711 17:40195767-40195789 ATGTGGGTGGCGGGGTACAGTGG + Intergenic
1147592719 17:41695206-41695228 TGGTGGGAGGAGGGGTACACAGG - Intergenic
1148848228 17:50541391-50541413 ACGTGGGAGGAAGAGGACAGAGG - Intronic
1149990314 17:61379597-61379619 ACGTGGGAGGAGGAGTGGGCAGG - Intronic
1150452276 17:65278935-65278957 ACGTGGGAGGATGATAACACAGG + Intergenic
1152846817 17:82605765-82605787 ACACAGGTGGAGGAGTCCACTGG - Intronic
1156103852 18:33633059-33633081 ACGTGGGAGGAGCAGCACAAGGG - Intronic
1157577757 18:48754983-48755005 CTGGGGGTGGAGGAGTGCACTGG + Intronic
1158895082 18:61905191-61905213 ACTTGGGTTGGGGAGGACACTGG - Intergenic
1158968603 18:62645037-62645059 TCGTGGGAAGAGGAGCACACAGG - Intergenic
1159002720 18:62988063-62988085 CCGTGGCAGGAGGAGCACACGGG - Intergenic
1159011709 18:63064163-63064185 ACGCGGGTGGAGGAGTAGATTGG + Intergenic
1159561255 18:69997430-69997452 AAGTGGGTGGAGGTGCACTCTGG + Intergenic
1160034504 18:75287760-75287782 ACAGGGGTGGCGGGGTACACCGG - Exonic
1160716218 19:577995-578017 ACGCTCGTGGAGGAGGACACGGG + Exonic
1161415418 19:4144083-4144105 CCGTTGGTGGAGGAGGAAACAGG - Intergenic
1161501908 19:4620864-4620886 ATGGGGGTGGAGGAGAGCACTGG + Intergenic
1162218480 19:9156595-9156617 ACGTGGCTGGAGGAGAAAACAGG - Exonic
1167939056 19:52931630-52931652 TTGTGGGTGGAGGATTACCCGGG + Intronic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
937702624 2:124881354-124881376 AGGTGGGTGGCAGAGTACCCAGG + Intronic
937840456 2:126519390-126519412 TCATGGGAGGAGGAGCACACAGG - Intergenic
937992222 2:127670880-127670902 ACGTCCTTGGAGGAATACACGGG - Intronic
939722472 2:145671570-145671592 AGGTGGGTGGAGGCCCACACAGG + Intergenic
940189050 2:151019039-151019061 ACATGGGTGGATGAGCAGACAGG + Intronic
946275661 2:218629735-218629757 GGGAGGGTGGAGGAGTACAGGGG + Intronic
1172998800 20:39090963-39090985 GGGTGGGTGGGGGAGGACACTGG - Intergenic
1173154170 20:40593859-40593881 ATGTAGGTGGAGGAGAGCACTGG - Intergenic
1174767314 20:53266158-53266180 TCAAGGGTGGAGGAGGACACAGG + Intronic
1175278666 20:57788318-57788340 AGGTGGCTGGAGGGGTCCACAGG - Intergenic
1176933551 21:14841899-14841921 ACGCTGGTGGAGGAGCACGCTGG - Intergenic
1178262996 21:31116960-31116982 TCGTGGATGGATGAGGACACTGG + Intergenic
1178444597 21:32627329-32627351 AAGTGGGTAAAGGGGTACACGGG + Intergenic
1180141927 21:45898262-45898284 CCGTGGAGGGAGGAGGACACTGG - Intronic
1180925884 22:19554838-19554860 TGGTGGATGGATGAGTACACTGG - Intergenic
1181577602 22:23805243-23805265 ACATGGGTGAGGGAGGACACTGG + Intronic
1184309839 22:43634021-43634043 AAGTGAGGGGAGGAGAACACAGG + Intronic
950171830 3:10844107-10844129 ACGTGGGTGAATGAGCACATGGG + Intronic
950856565 3:16111313-16111335 AAGCACGTGGAGGAGTACACAGG - Intergenic
960932892 3:122872803-122872825 TCGGGGGTGGGGGAGTACAGGGG - Intronic
967631063 3:191743288-191743310 TGGGGGGTGGGGGAGTACACAGG - Intergenic
968557013 4:1250574-1250596 ATGTGGTTGGTGGAGTGCACAGG + Intergenic
968816315 4:2823594-2823616 ATGTGGGTGGGGGAGTGCACTGG + Intronic
982138937 4:152299008-152299030 AGGTGGGAGGAGGAATCCACAGG + Intergenic
983224878 4:165076446-165076468 ACCTGGGTGGAGAGGTAGACAGG - Exonic
986152604 5:5140717-5140739 CCGCGGGTGGAGGAGGACGCGGG - Exonic
986733352 5:10650634-10650656 TCGTGGGTGTAGGTGCACACTGG + Intergenic
986850753 5:11810707-11810729 ACATGGGTGTATGAGTATACAGG + Intronic
987572712 5:19685846-19685868 AGGTGGCTGGAGGATCACACAGG + Intronic
989660379 5:43791461-43791483 ACATAGGTGGAGGAGCACAGAGG - Intergenic
994252661 5:97555163-97555185 ACGGGGGTGGATGAGTGCATTGG + Intergenic
995284211 5:110368440-110368462 TCGTGGGAGGGGGAGCACACAGG + Intronic
1001431873 5:171668312-171668334 ACGGGGCTGGTGGAGTCCACTGG - Intergenic
1001559031 5:172657321-172657343 CTGTGGGTGGAGGATTACCCAGG + Intronic
1002521097 5:179793649-179793671 AGGTGGGTGGAGGAGTTAGCCGG + Intronic
1005865021 6:29930887-29930909 GTGTGGGTGGAGGATTACTCAGG - Intergenic
1006368778 6:33632082-33632104 CTGTGGGTGGAGGATTACCCAGG - Intronic
1006908719 6:37550093-37550115 GCGAGGGTGGAGGACTGCACAGG + Intergenic
1007732363 6:43954850-43954872 CAGGGGGTGGAGGAGAACACAGG + Intergenic
1007777739 6:44233188-44233210 ACTTGGGTGGAGGTGGAGACAGG + Intronic
1016153652 6:140776649-140776671 ACCTGGGAGGCGGAGTACAGTGG - Intergenic
1016734810 6:147466360-147466382 GTGTGGGTGCAGGAGTATACAGG + Intergenic
1017409933 6:154157224-154157246 ACGTGGGTGGGGGGATAGACAGG - Intronic
1017522455 6:155214018-155214040 ACGTGGCTGCAGCAGTACCCGGG + Intronic
1018255282 6:161912406-161912428 ACGAGGGTGGGGGGGTACAGGGG - Intronic
1019628055 7:2031316-2031338 ACGTGGGTGGTGGAGGCCAGTGG - Intronic
1023042788 7:36186723-36186745 ACGTGGGTGGAGGAGTACACAGG + Intronic
1024248152 7:47485800-47485822 ACGTGGGTGCCTGGGTACACTGG + Intronic
1029243291 7:99179967-99179989 ATGTGGGTGGGGAACTACACAGG - Intronic
1034296061 7:149973220-149973242 CCGGGGGTGAAGGAGCACACGGG + Intergenic
1034386448 7:150744747-150744769 ACATGGGAGGAGGGGTGCACAGG - Intronic
1034427620 7:151022981-151023003 CAGTGGGTAGAGGAGTAGACGGG - Intronic
1036096869 8:5734025-5734047 TCGTGGGTGGAAGAGTTCACCGG + Intergenic
1036794338 8:11744398-11744420 AAGTGGCTGGAGGAGTTCCCGGG + Intronic
1037291166 8:17350633-17350655 AGGTGGGTGGAGATGGACACAGG - Intronic
1037513867 8:19610529-19610551 ACATCGGTGGAGGAACACACAGG + Intronic
1038466798 8:27772191-27772213 AGGTGTGTGGAGGAGCCCACAGG + Intronic
1039398498 8:37247633-37247655 AGGTGGGTGAAGGAGTGCTCTGG - Intergenic
1039984476 8:42436229-42436251 ACGTGGGTGGAGGAGCACTGGGG - Intronic
1040619005 8:49068358-49068380 TAGTGGGTGGAAGAGTACAGAGG + Intronic
1043300773 8:78728730-78728752 ACTTGGGGGGAGGAGATCACTGG + Intronic
1047119572 8:121885980-121886002 CCGTGTGTGGTGGAGCACACCGG + Intergenic
1047347055 8:124038765-124038787 TAGGGGGTGGAGGAGTTCACAGG + Intronic
1047528484 8:125654417-125654439 AAGAAGGTGGAGGAGTATACAGG + Intergenic
1048300085 8:133245018-133245040 ACGGGGCTGGAGGAGTTCATGGG + Intronic
1049496869 8:142939695-142939717 AGGTGGGTGGAGGAGCACAGTGG - Intergenic
1049496885 8:142939750-142939772 AGGTGGGTGGAGGAGCACGCTGG - Intergenic
1049496901 8:142939805-142939827 AGGTGGGTGGAGGAGCACGCTGG - Intergenic
1049888064 9:41562-41584 AAGGGGGAGGAGGAGTGCACAGG - Intergenic
1050689126 9:8205356-8205378 ACTTGGGTGGAGGATAAGACTGG - Intergenic
1057875434 9:98750176-98750198 AGTTGGGTGGAGGAGTAGGCGGG - Intronic
1058671890 9:107366993-107367015 ACCTGGGTGAAGGAGCACCCAGG + Intergenic
1060037018 9:120264313-120264335 ACGTGGGAGGAAGAATACACAGG - Intergenic
1062175819 9:135162289-135162311 ACGGGGGTGGAGATGGACACAGG + Intergenic
1186175916 X:6925690-6925712 ACATGGGAGGAGGTGTACATTGG + Intergenic
1189356467 X:40313631-40313653 ACTCGGGTGGAGGAGTACATGGG + Intergenic
1190511534 X:51178242-51178264 ATGTGGGTGAAGGATTACCCAGG - Intergenic
1190634478 X:52420459-52420481 ACGTGGGTGAAGGGGCCCACGGG - Intergenic
1199601095 X:149541496-149541518 CTGTGTGTGGAGCAGTACACGGG - Exonic